Transcript: Human XM_017000421.1

PREDICTED: Homo sapiens cilia and flagella associated protein 57 (CFAP57), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CFAP57 (149465)
Length:
3869
CDS:
124..3702

Additional Resources:

NCBI RefSeq record:
XM_017000421.1
NBCI Gene record:
CFAP57 (149465)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017000421.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000122288 CGGAGAGTGTTCCTTTAGCAA pLKO.1 1545 CDS 100% 3.000 2.400 N CFAP57 n/a
2 TRCN0000121565 CCTGGAACTATTTAAGGAATA pLKO.1 1389 CDS 100% 10.800 7.560 N CFAP57 n/a
3 TRCN0000145316 CAGAAAGTAATGGCCATTGTT pLKO.1 544 CDS 100% 5.625 3.938 N CFAP57 n/a
4 TRCN0000144093 CCCTGGAACTATTTAAGGAAT pLKO.1 1388 CDS 100% 4.950 3.465 N CFAP57 n/a
5 TRCN0000142487 GCTCAAGTCTTGCAGCTACAA pLKO.1 1776 CDS 100% 4.950 3.465 N CFAP57 n/a
6 TRCN0000122401 GCTGATGACAAGATTGTCGTT pLKO.1 742 CDS 100% 2.640 1.848 N CFAP57 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017000421.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09663 pDONR223 100% 53.7% 50.4% None (many diffs) n/a
2 ccsbBroad304_09663 pLX_304 0% 53.7% 50.4% V5 (many diffs) n/a
3 TRCN0000475723 CTCAGAAACACCATATCTTCAGTA pLX_317 16.3% 53.7% 50.4% V5 (many diffs) n/a
Download CSV