Construct: ORF TRCN0000475739
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF013068.1_s317c1
- Derived from:
- ccsbBroadEn_10093
- DNA Barcode:
- TTTACGTGGAAGTGGGGCCGGATC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- RPSAP58 (388524)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000475739
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 3921 | RPSA | ribosomal protein SA | NM_002295.6 | 99.5% | 99.3% | (many diffs) |
| 2 | human | 388524 | RPSAP58 | ribosomal protein SA pseudo... | NM_001355283.2 | 99.5% | 98.9% | (many diffs) |
| 3 | human | 388524 | RPSAP58 | ribosomal protein SA pseudo... | NM_001355287.2 | 99.5% | 98.9% | (many diffs) |
| 4 | human | 3921 | RPSA | ribosomal protein SA | NM_001304288.2 | 97.8% | 97.6% | (many diffs) |
| 5 | human | 204010 | RPSAP52 | ribosomal protein SA pseudo... | NR_026825.2 | 70.5% | (many diffs) | |
| 6 | human | 653162 | RPSAP9 | ribosomal protein SA pseudo... | NR_026890.1 | 59.7% | (many diffs) | |
| 7 | mouse | 16785 | Rpsa | ribosomal protein SA | NM_011029.4 | 89% | 98.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 954
- ORF length:
- 885
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gtccggagcc cttgatgtcc tgcaaatgaa ggaggaggat gtccttaagt 121 tccttgcagc aggaacccac ttaggtggca ccaatcttga cttccagatg gaacagtaca 181 tctataaaag gaaaagtgat ggcatctata tcataaatct caagaggacc tgggagaagc 241 ttctgctggc agctcgtgct attgttgcca ttgaaaaccc tgctgatgtc agtgttatat 301 cctccaggaa tactggccag agggctgtgc tgaagtttgc tgctgccact ggagccactc 361 caattgctgg ccgcttcact cctggaacct tcactaacca gatccaggca gccttctggg 421 agccacggct tcttgtggtt actgacccca gggctgacca ccagcctctc acggaggcat 481 cttatgttaa cctacctacc attgcgctgt gtaacacaga ttctcctctg cgctatgtgg 541 acattgccat cccatgcaac aacaagggag ctcactcagt gggtttgatg tggtggatgc 601 tggctcggga agttctgcgc atgcgtggca ccatttcccg tgaacaccca tgggaggtca 661 tgccTGATCT GTACTTCTAC AGAGATCCTG AAGAGATTGA AAAAGAAGAG CAGGCTGCTG 721 CTGAGAAGGC AGTGACCAAG GAGGAATTTC AGGGTGAATG GACTGCTCCC GCTCCTGAGT 781 TCACTGCTAC TCAGCCTGAG GTTGCAGACT GGTCTGAAGG TGTGCAGGTG CCCTCTGTGC 841 CTATTCAGCA ATTCCCTACT GAAGACTGGA GCGCTCAGCC TGCCATGGAA GACTGGTCTG 901 CAGCTCCCAC TGCTCAGGCC ACTGAATGGG TAGGAGCAAC CACTGACTGG TCTTTGCCAA 961 CTTTCTTGTA CAAAGTGGTT GATATCGGTA AGCCTATCCC TAACCCTCTC CTCGGTCTCG 1021 ATTCTACGTA GTAATGAACT AGTCCGTAAC TTGAAAGTAT TTCGATTTCT TGGCTTTATA 1081 TATCTTGTGG AAAGGACGAT TTACGTGGAA GTGGGGCCGG ATCACGCGTT AAGTCgacaa 1141 tcaacctctg gattacaaaa tttgtgaaag att