Construct: ORF TRCN0000475820
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF002011.1_s317c1
- Derived from:
- ccsbBroadEn_09366
- DNA Barcode:
- ATTCCTTCCGGTGTATCAGCCGTT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SFXN5 (94097)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000475820
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 94097 | SFXN5 | sideroflexin 5 | NM_144579.3 | 99.9% | 100% | 522C>T |
| 2 | human | 94097 | SFXN5 | sideroflexin 5 | NM_001371738.1 | 93.7% | 84.8% | 0_1ins61;107_108insGA;459C>T |
| 3 | human | 94097 | SFXN5 | sideroflexin 5 | NM_001371739.1 | 93.1% | 93.2% | 100_101ins69;453C>T |
| 4 | human | 94097 | SFXN5 | sideroflexin 5 | NM_001330400.2 | 92.1% | 90.4% | (many diffs) |
| 5 | human | 94097 | SFXN5 | sideroflexin 5 | NM_001371737.1 | 89.1% | 83.6% | 0_1ins61;109_163del;516C>T |
| 6 | human | 94097 | SFXN5 | sideroflexin 5 | NM_001330406.2 | 84.3% | 84% | 0_1ins112;58_112del;465C>T |
| 7 | human | 94097 | SFXN5 | sideroflexin 5 | NM_001371740.1 | 84.3% | 72.1% | 522C>T;741_742ins86;861_862ins73 |
| 8 | human | 94097 | SFXN5 | sideroflexin 5 | NM_001330402.2 | 82.5% | 81.4% | 522C>T;827_828ins118;843_844ins59 |
| 9 | human | 94097 | SFXN5 | sideroflexin 5 | NM_001371741.1 | 76.9% | 71.1% | 522C>T;625_626ins116;711_712ins118 |
| 10 | human | 94097 | SFXN5 | sideroflexin 5 | NM_001330401.2 | 74.3% | 56% | 522C>T;625_626ins202;759_760ins59 |
| 11 | human | 94097 | SFXN5 | sideroflexin 5 | NM_001330404.2 | 69.3% | 69.4% | 0_1ins312;210C>T |
| 12 | human | 94097 | SFXN5 | sideroflexin 5 | NM_001330410.2 | 69.3% | 69.4% | 0_1ins312;210C>T |
| 13 | human | 94097 | SFXN5 | sideroflexin 5 | NM_001330405.2 | 67.9% | 66% | (many diffs) |
| 14 | human | 94097 | SFXN5 | sideroflexin 5 | NM_001330407.2 | 63.2% | 61.3% | (many diffs) |
| 15 | human | 94097 | SFXN5 | sideroflexin 5 | NM_001371742.1 | 61.3% | 61.1% | 522C>T;625_626insCCAGTGCCA;627_628ins384 |
| 16 | human | 94097 | SFXN5 | sideroflexin 5 | NM_001330403.2 | 60% | 42.7% | (many diffs) |
| 17 | human | 94097 | SFXN5 | sideroflexin 5 | NM_001371743.1 | 59.6% | 59.7% | 522C>T;534_535ins411 |
| 18 | human | 94097 | SFXN5 | sideroflexin 5 | NM_001330411.2 | 55.4% | 42.4% | 0_1ins430;92C>T;170_171ins23 |
| 19 | human | 94097 | SFXN5 | sideroflexin 5 | NM_001330412.2 | 55.4% | 42.4% | 0_1ins430;92C>T;170_171ins23 |
| 20 | human | 94097 | SFXN5 | sideroflexin 5 | NM_001330408.2 | 51.9% | 50.8% | (many diffs) |
| 21 | human | 94097 | SFXN5 | sideroflexin 5 | NR_138476.2 | 23.6% | (many diffs) | |
| 22 | mouse | 94282 | Sfxn5 | sideroflexin 5 | NM_178639.4 | 89.7% | 97% | (many diffs) |
| 23 | mouse | 94282 | Sfxn5 | sideroflexin 5 | XM_006506816.4 | 84.8% | 91.4% | (many diffs) |
| 24 | mouse | 94282 | Sfxn5 | sideroflexin 5 | XM_030255684.1 | 59.5% | 64.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1089
- ORF length:
- 1020
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggcggataca gcgactacag catcggcggc ggcggctagt gccgctagcg 121 cctcgagcga tgcacctcct ttccaactgg gcaaaccccg cttccagcag acgtccttct 181 atggccgctt caggcacttc ttggatatca tcgaccctcg cacactcttt gtcactgaga 241 gacgtctcag agaggctgtg cagctgctgg aggactataa gcatgggacc ctgcgcccgg 301 gggtcaccaa tgaacagctc tggagtgcac agaaaatcaa gcaggctatt ctacatccgg 361 acaccaatga gaagatcttc atgccattta gaatgtcagg ttatattcct tttgggacgc 421 caattgtagt cggtcttctc ttgcccaacc agacactggc atccactgtc ttctggcagt 481 ggctgaacca gagccacaat gcctgtgtca actatgcaaa ccgcaatgcg accaagcctt 541 cacctgcatc caagttcatc cagggatacc tgggagctgt catcagcgct gtctccattg 601 ctgtgggcct taatgtcctg gttcagaaag ccaacaagtt caccccagcc acccgccttc 661 tcatccagag gtttgtgccg ttccctgctg tagccagtgc caatatctgc aatgtggtcc 721 tgatgcggta cggggagctg gaggaaggga ttgatgtcct ggacagcgat ggcaacctcg 781 tgggctcctc caagatcgca gcccgacacg ccctgctgga gacggcgctg acgcgagtgg 841 tcctgcccat gcccatcctg gtgctacccc cgatcgtcat gtccatgctg gagaagacgg 901 ctctcctgca ggcacgcccc cggctgctcc tccctgtgca aagcctcGTG TGCCTGGCAG 961 CCTTCGGCCT GGCCCTGCCG CTGGCCATCA GCCTCTTCCC GCAAATGTCA GAGATTGAAA 1021 CATCCCAATT AGAGCCGGAG ATAGCCCAGG CCACGAGCAG CCGGACAGTG GTGTACAACA 1081 AGGGGTTGTT GCCAACTTTC TTGTACAAAG TGGTTGATAT CGGTAAGCCT ATCCCTAACC 1141 CTCTCCTCGG TCTCGATTCT ACGTAGTAAT GAACTAGTCC GTAACTTGAA AGTATTTCGA 1201 TTTCTTGGCT TTATATATCT TGTGGAAAGG ACGAATTCCT TCCGGTGTAT CAGCCGTTAC 1261 GCGTTAAGTC gacaatcaac ctctggatta caaaatttgt gaaagatt