Construct: ORF TRCN0000475944
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF018406.1_s317c1
- Derived from:
- ccsbBroadEn_13424
- DNA Barcode:
- CTTGACTTTGATCCTACCCGATTT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- BEND6 (221336)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000475944
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 221336 | BEND6 | BEN domain containing 6 | XM_005248889.1 | 99.8% | 99.4% | 543A>C |
| 2 | human | 221336 | BEND6 | BEN domain containing 6 | XM_017010408.2 | 98.5% | 97.2% | 4_10delCTTCAAGinsT;549A>C |
| 3 | human | 221336 | BEND6 | BEN domain containing 6 | NM_152731.3 | 64.6% | 63.7% | 1_288del;292_298delCTTCAAGinsT;837A>C |
| 4 | human | 221336 | BEND6 | BEN domain containing 6 | XM_017010406.1 | 64.6% | 63.7% | 1_288del;292_298delCTTCAAGinsT;837A>C |
| 5 | human | 221336 | BEND6 | BEN domain containing 6 | XM_017010407.2 | 64.6% | 63.7% | 1_288del;292_298delCTTCAAGinsT;837A>C |
| 6 | human | 221336 | BEND6 | BEN domain containing 6 | XM_011514346.3 | 29.7% | 26.8% | (many diffs) |
| 7 | human | 221336 | BEND6 | BEN domain containing 6 | XR_001743233.2 | 19.6% | 1_627del;1170_2753delinsC | |
| 8 | human | 221336 | BEND6 | BEN domain containing 6 | XR_001743236.2 | 19% | 1_714del;1257_2840delinsC | |
| 9 | human | 221336 | BEND6 | BEN domain containing 6 | XR_001743235.2 | 19% | 1_717del;1260_2843delinsC |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 609
- ORF length:
- 543
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtt gttaccacaa gcagtcaccc agtttgaaga attggttggt atggccgagg 121 ctctgcttaa gggtggggga accatgtcta catctgcatc caccctctgg agagcaacaa 181 acaactcctc gccagattca tttgcctcaa catgcagtaa ttctaattct aactccagtt 241 caccagtttc cttaaagccT GAGGAAGAGC ATCAGACTGA TGAGAAACAG TTCCAGATTG 301 AAAAATGGCA GATTGCCCGT TGTAACAAGA GCAAGCCTCA GAAGTTTATT AATGATTTAA 361 TGCAAGTACT TTACACAAAT GAATACATGG CCACTCACAG CCTGACAGGG GCAAAATCCT 421 CTACTTCAAG GGACAAAGCT GTAAAACCAG CTATGAATCA GAATGAAGTC CAAGAAATCA 481 TAGGAGTAAC AAAACAATTA TTTCCCAATA CGGATGATGT TTCAATTAGG AGAATGATAG 541 GGCAAAAGCT AAACAACTGT ACCAAGAAGC CAAATTTAAG CAAAAATCTT AACTCTCAGG 601 ATATTAACTA CCCAACTTTC TTGTACAAAG TGGTTGATAT CGGTAAGCCT ATCCCTAACC 661 CTCTCCTCGG TCTCGATTCT ACGTAGTAAT GAACTAGTCC GTAACTTGAA AGTATTTCGA 721 TTTCTTGGCT TTATATATCT TGTGGAAAGG ACGACTTGAC TTTGATCCTA CCCGATTTAC 781 GCGTTAAGTC gacaatcaac ctctggatta caaaatttgt gaaagatt