Transcript: Human XR_001743233.2

PREDICTED: Homo sapiens BEN domain containing 6 (BEND6), transcript variant X6, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
BEND6 (221336)
Length:
2753
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001743233.2
NBCI Gene record:
BEND6 (221336)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001743233.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000136351 GCTCTTATCATAGCAGCCAAA pLKO.1 1508 3UTR 100% 4.050 3.240 N BEND6 n/a
2 TRCN0000138565 CGACAGTCTTTGGTCATGCTT pLKO.1 543 3UTR 100% 3.000 2.400 N BEND6 n/a
3 TRCN0000136472 CCACCACACTTCTGAAGAATA pLKO.1 1834 3UTR 100% 13.200 9.240 N BEND6 n/a
4 TRCN0000216406 GATTTAATGCAAGTACTTTAC pLKO.1 916 3UTR 100% 10.800 7.560 N Bend6 n/a
5 TRCN0000134811 CCAGCTATGAATCAGAATGAA pLKO.1 1009 3UTR 100% 5.625 3.938 N BEND6 n/a
6 TRCN0000135776 CAGAGACAATGGACTCAGAAA pLKO.1 340 3UTR 100% 4.950 3.465 N BEND6 n/a
7 TRCN0000133737 CCAGTCAAATAAGCATGCAAT pLKO.1 1412 3UTR 100% 4.950 3.465 N BEND6 n/a
8 TRCN0000136206 GAACCATGTCTACATCTGCAT pLKO.1 701 3UTR 100% 2.640 1.848 N BEND6 n/a
9 TRCN0000138545 CAAAGGAAGAATTGTGCGCCA pLKO.1 466 3UTR 100% 0.540 0.378 N BEND6 n/a
10 TRCN0000133650 GATGAGAAACAGTTCCAGATT pLKO.1 841 3UTR 100% 4.950 2.970 N BEND6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001743233.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13424 pDONR223 100% 19.7% None 1_627del;1171_2753del n/a
2 ccsbBroad304_13424 pLX_304 0% 19.7% V5 1_627del;1171_2753del n/a
3 TRCN0000475944 CTTGACTTTGATCCTACCCGATTT pLX_317 63.9% 19.6% V5 1_627del;1170_2753delinsC n/a
Download CSV