Construct: ORF TRCN0000475987
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF014833.1_s317c1
- Derived from:
- ccsbBroadEn_04863
- DNA Barcode:
- TTGTATTCCTGCCTATCTCCGAGC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- LYPD6 (130574)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000475987
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 130574 | LYPD6 | LY6/PLAUR domain containing 6 | NM_001195685.1 | 100% | 100% | |
| 2 | human | 130574 | LYPD6 | LY6/PLAUR domain containing 6 | NM_194317.5 | 100% | 100% | |
| 3 | human | 130574 | LYPD6 | LY6/PLAUR domain containing 6 | XM_024452698.1 | 100% | 100% | |
| 4 | human | 130574 | LYPD6 | LY6/PLAUR domain containing 6 | XM_024452699.1 | 100% | 100% | |
| 5 | human | 130574 | LYPD6 | LY6/PLAUR domain containing 6 | XM_024452700.1 | 100% | 100% | |
| 6 | human | 130574 | LYPD6 | LY6/PLAUR domain containing 6 | XM_024452701.1 | 100% | 100% | |
| 7 | mouse | 320343 | Lypd6 | LY6/PLAUR domain containing 6 | NM_177139.5 | 89.4% | 94.7% | (many diffs) |
| 8 | mouse | 320343 | Lypd6 | LY6/PLAUR domain containing 6 | XM_011239116.2 | 89.4% | 94.7% | (many diffs) |
| 9 | mouse | 320343 | Lypd6 | LY6/PLAUR domain containing 6 | NR_033304.2 | 12.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 582
- ORF length:
- 513
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggaacctggc cctgctctgg cctggctcct gctcctgagc ctgctggcgg 121 attgtctgaa agctgctcag tcccgagact tcacagtgaa agacattatc tacctccatc 181 cttcaaccac accatatcct ggtggattta aatgtttcac ctgtgaaaag gcagcagaca 241 attatgagtg caaccgatgg gctccagaca tctactgccc tcgagagacc agatactgct 301 acacTCAGCA CACAATGGAA GTCACAGGAA ACAGTATCTC AGTCACCAAA CGCTGTGTCC 361 CACTGGAAGA GTGCTTATCC ACTGGCTGCA GAGACTCCGA GCATGAAGGC CACAAGGTCT 421 GCACTTCTTG TTGTGAAGGA AATATCTGTA ACTTGCCACT GCCCCGAAAT GAAACTGATG 481 CCACATTTGC CACGACGTCA CCTATAAATC AGACAAATGG GCACCCACGC TGTATGTCAG 541 TGATAGTGTC CTGCTTGTGG TTGTGGTTAG GGCTCATGTT ATTGCCAACT TTCTTGTACA 601 AAGTGGTTGA TATCGGTAAG CCTATCCCTA ACCCTCTCCT CGGTCTCGAT TCTACGTAGT 661 AATGAACTAG TCCGTAACTT GAAAGTATTT CGATTTCTTG GCTTTATATA TCTTGTGGAA 721 AGGACGATTG TATTCCTGCC TATCTCCGAG CACGCGTTAA GTCgacaatc aacctctgga 781 ttacaaaatt tgtgaaagat t