Construct: ORF TRCN0000476001
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF006192.1_s317c1
- Derived from:
- ccsbBroadEn_03340
- DNA Barcode:
- TAATACATAACGCTCGGGTGAAGC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- LSR (51599)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000476001
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 51599 | LSR | lipolysis stimulated lipopr... | NM_205834.3 | 100% | 100% | |
| 2 | human | 51599 | LSR | lipolysis stimulated lipopr... | XM_005258980.2 | 99.8% | 99.8% | 1155_1156insGAA |
| 3 | human | 51599 | LSR | lipolysis stimulated lipopr... | NM_015925.6 | 97% | 97% | 717_718ins57 |
| 4 | human | 51599 | LSR | lipolysis stimulated lipopr... | NM_001260489.1 | 96.9% | 96.9% | 717_718ins57;1098_1099insGAA |
| 5 | human | 51599 | LSR | lipolysis stimulated lipopr... | XM_011527026.2 | 92.4% | 92.2% | 775_776ins147 |
| 6 | human | 51599 | LSR | lipolysis stimulated lipopr... | NM_205835.3 | 89.5% | 89.3% | 718_719ins204 |
| 7 | human | 51599 | LSR | lipolysis stimulated lipopr... | XM_005258982.2 | 89.3% | 89.2% | 718_719ins204;951_952insGAA |
| 8 | human | 51599 | LSR | lipolysis stimulated lipopr... | NM_001260490.1 | 83.3% | 83.2% | 598_599ins324 |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 2016
- ORF length:
- 1947
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gcaacaggac ggacttggag tagggacaag gaacggaagt gggaagggga 121 ggagcgtgca cccctcctgg ccttggtgcg cgccgcgccc cctaaggtac tttggaaggg 181 acgcgcgggc cagacgcgcc cagacggccg cgatggcgct gttggccggc gggctctcca 241 gagggctggg ctcccacccg gccgccgcag gccgggacgc ggtcgtcttc gtgtggcttc 301 tgcttagcac ctggtgcaca gctcctgcca gggccatcca ggtgaccgtg tccaacccct 361 accacgtggt gatcctcttc cagcctgtga ccctgccctg tacctaccag atgacctcga 421 cccccacgca acccatcgtc atctggaagt acaagtcttt ctgccgggac cgcatcgccg 481 atgccttctc cccggccagc gtcgacaacc agctcaatgc ccagctggca gccgggaacc 541 caggctacaa cccctacgtt gagtgccagg acagcgtgcg caccgtcagg gtcgtggcca 601 ccaagcaggg caacgctgtg accctgggag attactacca gggccggagg attaccatca 661 ccggaaatgc tgacctgacc tttgaccaga cggcgtgggg ggacagtggt gtgtattact 721 gctccgtggt ctcagcccag gacctccagg ggaacaatga ggcctacgca gagctcatcg 781 tccttgggag gacctcaggg gtggctgagc tcttacctgg ttttcaggcg gggcccatag 841 aagactggct cttcgtggtt gtggtatgcc tggctgcctt cctcatcttc ctcctcctgg 901 gcatctgctg gtgccagtgc tgcccgcaca cttgctgctg ctacgtcagg tgcccctgct 961 gcccagacaa gtgctgctgc cccgaggccc tgtatgccgc cggcaaagca gccacctcag 1021 gtgttcccag catttatgcc cccagcacct atgcccacct gtctcccgcc aagaccccac 1081 ccccaccagc tatgattccc atgggccctg cctacaacgg gtaccctgga ggataccctg 1141 gagacgttga caggagtagc tcagctggtg gccaaggctc ctatgtaccc ctgcttcggg 1201 acacggacag cagtgtggcc tctgaagtcc gcagtggcta caggattcag gccagccagc 1261 aggacgactc catgcgggtc ctgtactaca tggagaagga gctggccaac ttcgaccctt 1321 ctcgacctgg cccccccagt ggccgtgtgg agcgggccat gagtgaagtc acctccctcc 1381 acgaggacga ctggcgatct cggccttccc ggggccctgc cctcaccccg atccgggatg 1441 aggagtgggg tggccactcc ccccggagtc ccaggggatg ggaccaggag cccgccaggg 1501 agcaggcagg cgggggctgg cgggccaggc ggccccgggc ccgctccgtg gacgccctgg 1561 acgacctcac cccgccgagc accgccgagt cagggagcag gtctcccacg agtaatggtg 1621 ggagaagccg ggcctacatg cccccgcgga gccgcagccg ggacgacctc tatgaccaag 1681 acgactcgag ggacttccca cgctcccggg acccccacta cgacgacttc aggtctcggg 1741 agcgcccTCC TGCCGACCCC AGGTCCCACC ACCACCGTAC CCGGGACCCT CGGGACAACG 1801 GCTCCAGGTC CGGGGACCTC CCCTATGATG GGCGGCTACT GGAGGAGGCT GTGAGGAAGA 1861 AGGGGTCGGA GGAGAGGAGG AGACCCCACA AGGAGGAGGA GGAAGAGGCC TACTACCCGC 1921 CCGCGCCGCC CCCGTACTCG GAGACCGACT CGCAGGCGTC CCGAGAGCGC AGGCTCAAGA 1981 AGAACTTGGC CCTGAGTCGG GAAAGTTTAG TCGTCTTGCC AACTTTCTTG TACAAAGTGG 2041 TTGATATCGG TAAGCCTATC CCTAACCCTC TCCTCGGTCT CGATTCTACG TAGTAATGAA 2101 CTAGTCCGTA ACTTGAAAGT ATTTCGATTT CTTGGCTTTA TATATCTTGT GGAAAGGACG 2161 ATAATACATA ACGCTCGGGT GAAGCACGCG TTAAGTCgac aatcaacctc tggattacaa 2221 aatttgtgaa agatt