Transcript: Human NM_015925.6

Homo sapiens lipolysis stimulated lipoprotein receptor (LSR), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Homo sapiens (human)
Gene:
LSR (51599)
Length:
2235
CDS:
224..2116

Additional Resources:

NCBI RefSeq record:
NM_015925.6
NBCI Gene record:
LSR (51599)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015925.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000429922 ATGCGGGTCCTGTACTACATG pLKO_005 1370 CDS 100% 4.950 6.930 N LSR n/a
2 TRCN0000422481 TGCCCTGTACCTACCAGATGA pLKO_005 549 CDS 100% 4.950 6.930 N LSR n/a
3 TRCN0000422765 GCTCTTCGTGGTTGTGGTATG pLKO_005 946 CDS 100% 6.000 4.800 N LSR n/a
4 TRCN0000060339 CCACGAGTAATGGTGGGAGAA pLKO.1 1704 CDS 100% 4.050 3.240 N LSR n/a
5 TRCN0000060338 CATCTGGAAGTACAAGTCTTT pLKO.1 595 CDS 100% 4.950 3.465 N LSR n/a
6 TRCN0000060341 GCGCAGGCTCAAGAAGAACTT pLKO.1 2065 CDS 100% 4.950 3.465 N LSR n/a
7 TRCN0000432512 AGGATACCCTGGAGACGTTGA pLKO_005 1228 CDS 100% 4.050 2.835 N LSR n/a
8 TRCN0000060340 GAGGATTACCATCACCGGAAA pLKO.1 802 CDS 100% 4.050 2.835 N LSR n/a
9 TRCN0000060342 CCTAAGGTACTTTGGAAGGGA pLKO.1 316 CDS 100% 0.750 0.525 N LSR n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015925.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03340 pDONR223 100% 97% 97% None 717_718ins57 n/a
2 ccsbBroad304_03340 pLX_304 0% 97% 97% V5 717_718ins57 n/a
3 TRCN0000476001 TAATACATAACGCTCGGGTGAAGC pLX_317 14.1% 97% 97% V5 717_718ins57 n/a
Download CSV