Construct: ORF TRCN0000476165
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF004410.1_s317c1
- Derived from:
- ccsbBroadEn_13227
- DNA Barcode:
- AGCAGACAAGTCACAGTGCGCCGT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- RAD9B (144715)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000476165
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 144715 | RAD9B | RAD9 checkpoint clamp compo... | NM_001286533.2 | 100% | 100% | |
2 | human | 144715 | RAD9B | RAD9 checkpoint clamp compo... | NM_001286534.2 | 100% | 100% | |
3 | human | 144715 | RAD9B | RAD9 checkpoint clamp compo... | XM_017018882.2 | 100% | 100% | |
4 | human | 144715 | RAD9B | RAD9 checkpoint clamp compo... | NM_001368054.1 | 84.9% | 84.9% | 0_1ins117 |
5 | human | 144715 | RAD9B | RAD9 checkpoint clamp compo... | NM_001368055.1 | 84.9% | 84.9% | 0_1ins117 |
6 | human | 144715 | RAD9B | RAD9 checkpoint clamp compo... | XM_017018879.2 | 84.9% | 84.9% | 0_1ins117 |
7 | human | 144715 | RAD9B | RAD9 checkpoint clamp compo... | XM_017018880.2 | 84.9% | 84.9% | 0_1ins117 |
8 | human | 144715 | RAD9B | RAD9 checkpoint clamp compo... | NM_001286531.2 | 75% | 75% | 1_258del |
9 | human | 144715 | RAD9B | RAD9 checkpoint clamp compo... | NM_001286532.2 | 75% | 75% | 1_258del |
10 | human | 144715 | RAD9B | RAD9 checkpoint clamp compo... | NM_001368051.1 | 75% | 75% | 1_258del |
11 | human | 144715 | RAD9B | RAD9 checkpoint clamp compo... | XM_024448860.1 | 75% | 75% | 1_258del |
12 | human | 144715 | RAD9B | RAD9 checkpoint clamp compo... | XM_024448861.1 | 75% | 75% | 1_258del |
13 | human | 144715 | RAD9B | RAD9 checkpoint clamp compo... | NM_001368056.1 | 73.8% | 69.1% | (many diffs) |
14 | human | 144715 | RAD9B | RAD9 checkpoint clamp compo... | XM_017018881.2 | 73.8% | 69.1% | (many diffs) |
15 | human | 144715 | RAD9B | RAD9 checkpoint clamp compo... | XM_005253849.5 | 71.4% | 66% | (many diffs) |
16 | human | 144715 | RAD9B | RAD9 checkpoint clamp compo... | XM_017018877.2 | 70.9% | 70.9% | 1_318del |
17 | human | 144715 | RAD9B | RAD9 checkpoint clamp compo... | NM_001368053.1 | 66.9% | 63.3% | (many diffs) |
18 | human | 144715 | RAD9B | RAD9 checkpoint clamp compo... | XM_011537972.3 | 65.9% | 65.9% | 1_402del |
19 | human | 144715 | RAD9B | RAD9 checkpoint clamp compo... | NM_001286536.2 | 63.5% | 54.6% | (many diffs) |
20 | human | 144715 | RAD9B | RAD9 checkpoint clamp compo... | NM_001286535.2 | 62.1% | 62.1% | 1_474del |
21 | human | 144715 | RAD9B | RAD9 checkpoint clamp compo... | NM_152442.4 | 60.1% | 59.4% | (many diffs) |
22 | human | 144715 | RAD9B | RAD9 checkpoint clamp compo... | NM_001368052.1 | 55.6% | 52.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 846
- ORF length:
- 777
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gattcaacca agattgcttg ctgatgccat tgttcttttt acatcaagtc 121 aagaggaagt tactcttgct gttactccac tgaatttttg cctcaagagt tctaatgagg 181 aatcaatgga tttgagcaat gctgtacaca gtgagatgtt tgttggctca gatgagtttg 241 acttctttca aattggaatg gacactgaga taacattttg tttcaaagaa ttgaagggaa 301 tactgacatt ttcagaagct acacatgctc ctatatccat ttattttgat ttccctggga 361 aacctctggc tttgagtatt gatgatatgt tagtggaagc taactttatt ttggccacat 421 tagctgatga acaaagtaga gcatcttcac cacagtcact gtgtctttca cagaaacgaa 481 aaaggtcaga tctgattgaa aaaaaggctg gcaaaaatgt aactggccag gccctggaat 541 gtattTCAAA AAAAGCAGCA CCAAGAAGGC TTTATCCTAA GGAGACTCTC ACAAACATAT 601 CTGCATTGGA AAACTGTGGC AGCCCTGCAA TGAAAAGAGT GGATGGAGAT GTCAGTGAAG 661 TATCAGAAAG CAGTGTCAGC AACACAGAGG AAGTGCCAGG GTCTCTGTGT CTCAGAAAGT 721 TTTCTTGCAT GTTCTTTGGA GCAGTTTCTT CTGACCAGCA AGAACACTTC AACCACCCTT 781 TCGACAGTCT GGCAAGAGCA AGTGACAGTG AAGAGGACAT GAATAATGGC AGTTTCTCTA 841 TATTCTTGCC AACTTTCTTG TACAAAGTGG TTGATATCGG TAAGCCTATC CCTAACCCTC 901 TCCTCGGTCT CGATTCTACG TAGTAATGAA CTAGTCCGTA ACTTGAAAGT ATTTCGATTT 961 CTTGGCTTTA TATATCTTGT GGAAAGGACG AAGCAGACAA GTCACAGTGC GCCGTACGCG 1021 TTAAGTCgac aatcaacctc tggattacaa aatttgtgaa agatt