Transcript: Human XM_017018880.2

PREDICTED: Homo sapiens RAD9 checkpoint clamp component B (RAD9B), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RAD9B (144715)
Length:
4756
CDS:
522..1184

Additional Resources:

NCBI RefSeq record:
XM_017018880.2
NBCI Gene record:
RAD9B (144715)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017018880.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000157271 GCCTGAGTTTGGAGTGGAATA pLKO.1 2191 3UTR 100% 10.800 7.560 N RAD9B n/a
2 TRCN0000150764 GAATGGACACTGAGATAACAT pLKO.1 592 CDS 100% 5.625 3.938 N RAD9B n/a
3 TRCN0000155318 GCTGTACACAGTGAGATGTTT pLKO.1 537 CDS 100% 5.625 3.938 N RAD9B n/a
4 TRCN0000156129 CTTGCTGTTACTCCACTGAAT pLKO.1 471 5UTR 100% 4.950 3.465 N RAD9B n/a
5 TRCN0000154732 GAGATGTTTGTTGGCTCAGAT pLKO.1 549 CDS 100% 4.950 3.465 N RAD9B n/a
6 TRCN0000154487 GCATGTTCTTTGGAGCAGTTT pLKO.1 1063 CDS 100% 4.950 3.465 N RAD9B n/a
7 TRCN0000154622 GCCACATTAGCTGATGAACAA pLKO.1 750 CDS 100% 4.950 3.465 N RAD9B n/a
8 TRCN0000154846 GCCATCAAGATGGCTTGAAAT pLKO.1 1536 3UTR 100% 1.320 0.924 N RAD9B n/a
9 TRCN0000155179 GCCTGGCTAATTTCTGGTATT pLKO.1 1881 3UTR 100% 10.800 6.480 N RAD9B n/a
10 TRCN0000430981 GCCACCATGCCTGGCTAATTT pLKO_005 1873 3UTR 100% 15.000 7.500 Y GTF2IRD2 n/a
11 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 2975 3UTR 100% 13.200 6.600 Y LIAS n/a
12 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 1980 3UTR 100% 5.625 2.813 Y KLHL30 n/a
13 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 1980 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017018880.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13227 pDONR223 100% 84.9% 84.9% None 0_1ins117 n/a
2 ccsbBroad304_13227 pLX_304 0% 84.9% 84.9% V5 0_1ins117 n/a
3 TRCN0000476165 AGCAGACAAGTCACAGTGCGCCGT pLX_317 38.8% 84.9% 84.9% V5 0_1ins117 n/a
4 ccsbBroadEn_13226 pDONR223 100% 80.8% 79.7% None (many diffs) n/a
5 ccsbBroad304_13226 pLX_304 0% 80.8% 79.7% V5 (many diffs) n/a
Download CSV