Construct: ORF TRCN0000476240
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF010352.1_s317c1
- Derived from:
- ccsbBroadEn_13544
- DNA Barcode:
- CTTCAACCATAGCAGAAAAGTGCA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- FBXW12 (285231)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000476240
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 285231 | FBXW12 | F-box and WD repeat domain ... | NM_001159927.1 | 58.3% | 44.7% | (many diffs) |
| 2 | human | 285231 | FBXW12 | F-box and WD repeat domain ... | NM_001159929.1 | 56.7% | 56.8% | (many diffs) |
| 3 | human | 285231 | FBXW12 | F-box and WD repeat domain ... | NM_207102.2 | 54.4% | 54.5% | (many diffs) |
| 4 | human | 285231 | FBXW12 | F-box and WD repeat domain ... | XM_017006224.1 | 54.4% | 54.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 855
- ORF length:
- 786
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gatctggtca agcccagtcc aggagttcca tttctcaaat ctggtaaccc 121 tccctcagat gcatctcgcc atcactatgg atcggaaaaa aactatcaaa gtgtggaact 181 gtcaggacag ggacgctctg gctgttctcc ccatgccaca gccctgttat tgcatggaag 241 cctatcttac aaaggatggc ccattcctga tggttggcga tgctgcaggt gacatctaca 301 catttacact gcctgggtta agagatgttt ctaaagttac tgcatttcaa tatggtattg 361 tacttctaca ctgctctcct gacaagaaat gggtatttgc atgtgggaca tacagtcgta 421 ccttgccaca ggtattcctc acagagtcct tactgagacc atcagaaggc agtgatcctc 481 tgtctacctt tctcccacat aaattatgtg ccagcgccTG CTGGACCCCA AAGGTGAAAA 541 ACAGGATAAC ACTGATGTCC CAAAGTAGCA CTGGAAAAAA GACAGAATTT ATCACCTTTG 601 ATCTAACAAC CAAGAAGACT GGAGGCCAAA CAGTCATCCA AGCATATGAG ATCGCAAGTT 661 TCCAGGTGGC AGCTCATCTG AAGTGCCCTA TCTGGATGGG AGCCAGTGAT GGATATATGA 721 TTGTCTTTAC CAGTGGACCA TACTTGTTAC TCTTCAGCAT CACTGGCTTC CTGCTGCAAC 781 GATTTGAGGA CCATCAGGCA GCCATCAACA ACTTCTGGGT GGTATGTATG ATTCTCCTCC 841 ACTGCTTTTT GATCTTGCCA ACTTTCTTGT ACAAAGTGGT TGATATCGGT AAGCCTATCC 901 CTAACCCTCT CCTCGGTCTC GATTCTACGT AGTAATGAAC TAGTCCGTAA CTTGAAAGTA 961 TTTCGATTTC TTGGCTTTAT ATATCTTGTG GAAAGGACGA CTTCAACCAT AGCAGAAAAG 1021 TGCAACGCGT TAAGTCgaca atcaacctct ggattacaaa atttgtgaaa gatt