Construct: ORF TRCN0000476260
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF018557.1_s317c1
- Derived from:
- ccsbBroadEn_02291
- DNA Barcode:
- TTAGTGTACAGACCGGTTCAAAGC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- BCL2L10 (10017)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000476260
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 10017 | BCL2L10 | BCL2 like 10 | NM_020396.3 | 100% | 100% | |
2 | human | 10017 | BCL2L10 | BCL2 like 10 | NM_001306168.1 | 84.6% | 68.2% | 489_558del;683_723del |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 681
- ORF length:
- 612
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggttgaccag ttgcgggagc gcaccaccat ggccgacccg ctgcgggagc 121 gcaccgagct gttgctggcc gactacctgg ggtactgcgc ccgggaaccc ggcacccccg 181 agccggcgcc atccacgccc gaggccgccg tgctgcgctc cgcggccgcc aggttacggc 241 agattcaccg gtcctttttc tccgcctacc tcggctaccc cgggaaccgc ttcgagctgg 301 tggcgctgat ggcggattcc gtgctctccg acagccccgg ccccacctgg ggcagagtgg 361 tgacgctcgt gaccTTCGCA GGGACGCTGC TGGAGAGAGG GCCGCTGGTG ACCGCCCGGT 421 GGAAGAAGTG GGGCTTCCAG CCGCGGCTAA AGGAGCAGGA GGGCGACGTC GCCCGGGACT 481 GCCAGCGCCT GGTGGCCTTG CTGAGCTCGC GGCTCATGGG GCAGCACCGC GCCTGGCTGC 541 AGGCTCAGGG CGGCTGGGAT GGCTTTTGTC ACTTCTTCAG GACCCCCTTT CCACTGGCTT 601 TTTGGAGAAA ACAGCTGGTC CAGGCTTTTC TGTCATGCTT GTTAACAACA GCCTTCATTT 661 ATCTCTGGAC ACGATTATTA TTGCCAACTT TCTTGTACAA AGTGGTTGAT ATCGGTAAGC 721 CTATCCCTAA CCCTCTCCTC GGTCTCGATT CTACGTAGTA ATGAACTAGT CCGTAACTTG 781 AAAGTATTTC GATTTCTTGG CTTTATATAT CTTGTGGAAA GGACGATTAG TGTACAGACC 841 GGTTCAAAGC ACGCGTTAAG TCgacaatca acctctggat tacaaaattt gtgaaagatt