Transcript: Human NM_001306168.1

Homo sapiens BCL2 like 10 (BCL2L10), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
BCL2L10 (10017)
Length:
1325
CDS:
50..775

Additional Resources:

NCBI RefSeq record:
NM_001306168.1
NBCI Gene record:
BCL2L10 (10017)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001306168.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000033594 CATTTATCTCTGGACACGATT pLKO.1 707 CDS 100% 4.950 6.930 N BCL2L10 n/a
2 TRCN0000033596 CTTGTTAACAACAGCCTTCAT pLKO.1 689 CDS 100% 4.950 6.930 N BCL2L10 n/a
3 TRCN0000413184 GGACACGATTATTATGAGTTT pLKO_005 718 CDS 100% 4.950 6.930 N BCL2L10 n/a
4 TRCN0000033595 CGGCAGATTCACCGGTCCTTT pLKO.1 218 CDS 100% 1.650 2.310 N BCL2L10 n/a
5 TRCN0000033597 GCCGCCAGGTTACGGCAGATT pLKO.1 206 CDS 100% 0.000 0.000 N BCL2L10 n/a
6 TRCN0000427739 GCCCAACTGTGACCAACTAAA pLKO_005 764 CDS 100% 13.200 9.240 N BCL2L10 n/a
7 TRCN0000429404 GAGAACAAGAACTGAGGGAAA pLKO_005 797 3UTR 100% 4.050 2.835 N BCL2L10 n/a
8 TRCN0000033598 CGTGACCTTCGCAGGGACGCT pLKO.1 349 CDS 100% 0.000 0.000 N BCL2L10 n/a
9 TRCN0000429704 CAACTAAATGACAGATGTGTG pLKO_005 777 3UTR 100% 4.050 2.430 N BCL2L10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001306168.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02291 pDONR223 100% 84.6% 68.2% None 489_558del;683_723del n/a
2 ccsbBroad304_02291 pLX_304 0% 84.6% 68.2% V5 489_558del;683_723del n/a
3 TRCN0000476260 TTAGTGTACAGACCGGTTCAAAGC pLX_317 49.9% 84.6% 68.2% V5 489_558del;683_723del n/a
Download CSV