Construct: ORF TRCN0000476466
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF017792.1_s317c1
- Derived from:
- ccsbBroadEn_04602
- DNA Barcode:
- GTCCTCGCTTCACTGCGTAAACGG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- ARMC6 (93436)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000476466
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 93436 | ARMC6 | armadillo repeat containing 6 | NM_033415.4 | 100% | 100% | |
| 2 | human | 93436 | ARMC6 | armadillo repeat containing 6 | XM_005260157.3 | 100% | 100% | |
| 3 | human | 93436 | ARMC6 | armadillo repeat containing 6 | XM_017027485.2 | 100% | 100% | |
| 4 | human | 93436 | ARMC6 | armadillo repeat containing 6 | NM_001199196.2 | 95% | 95% | 1_75del |
| 5 | human | 93436 | ARMC6 | armadillo repeat containing 6 | XM_017027484.2 | 85% | 86.1% | 1216_1238del;1257_1258ins194 |
| 6 | human | 93436 | ARMC6 | armadillo repeat containing 6 | XR_001753798.2 | 48.9% | 1_367del;1313_1882del;2366_2916del |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1497
- ORF length:
- 1428
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggtctccaag cgcattgccc aggagacctt tgatgcagct gtgcgcgaga 121 acatcgagga gtttgcgatg gggccagagg aggcagtgaa agaggccgtg gagcagtttg 181 aatcgcaagg ggttgatctg agcaacattg taaagacggc acctaaagtc tctgcagacg 241 gatcccagga gcccacacat gacatcctgc agatgctcag tgacctccag gagtctgtgg 301 ccagctctcg cccccaggag gtgtcagcat acctcacccg cttctgcgac cagtgcaaac 361 aggacaaggc ctgccgcttc ctcgcggccc agaagggggc ctaccccatc atcttcactg 421 cctggaagct ggccactgca ggtgaccagg gccttctgct ccagtccctc aatgccctgt 481 cggtgctgac tgatggacag ccagacctcc tggatgccca gggcctgcag ctcctagtgg 541 ccacgctgac ccagaatgct gatgaggctg acctgacctg ctctgggatc cgctgtgtgc 601 gtcacgcttg cctgaaacat gaacagaatc ggcaagacct ggtgaaagct ggcgtgctgc 661 ctctgctgac tggtgccatc acccatcatg gccaccacac tgacgtggtc agggaagcct 721 gctgggccct gcgtgtcatg accttcgatg acgacatccg tgtgcccttt ggccatgccc 781 acaaccatgc caagatgatt gtgcaggaga acaaaggctt gaaggtgctc atcgaagcca 841 ccaaagcgtt cctggataac cctggcatcc tgagcgagct ctgtggaacc ctgtcccgcc 901 tggccattcg caacgagttc tgccaggagg tcgtcgacct cgggggcctg agcattctgg 961 tgtccctgct agccgactgc aatgaccacc agatgaggga ccagagcggc gttcaggagc 1021 tcgtgaagca agtgctgagc accctgcgag ccatcgcagg caacgacgac gtgaaagatg 1081 ctattgtccg tgctggtggg acggagtcca tcgtggctgc tatgacccag catctgacca 1141 gcccccaggt gtgtgagcag agctgcgcgg ccctgtgctt cctggccctg cgtaagcccg 1201 acaacagccg catcatcgtg gagggtggcg gggctgtggc agcacTGCAG GCCATGAAGG 1261 CACACCCGCA GAAGGCCGGC GTGCAGAAAC AGGCTTGCAT GCTGATCCGA AACCTGGTGG 1321 CCCACGGCCA GGCCTTCTCG AAGCCCATCC TGGACCTGGG GGCTGAGGCA CTCATCATGC 1381 AGGCCCGATC TGCCCACCGT GACTGTGAGG ACGTGGCCAA GGCCGCCCTG CGGGACCTGG 1441 GTTGTCATGT CGAGCTCCGA GAGCTGTGGA CAGGCCAGAG GGGCAACCTG GCGCCATTGC 1501 CAACTTTCTT GTACAAAGTG GTTGATATCG GTAAGCCTAT CCCTAACCCT CTCCTCGGTC 1561 TCGATTCTAC GTAGTAATGA ACTAGTCCGT AACTTGAAAG TATTTCGATT TCTTGGCTTT 1621 ATATATCTTG TGGAAAGGAC GAGTCCTCGC TTCACTGCGT AAACGGACGC GTTAAGTCga 1681 caatcaacct ctggattaca aaatttgtga aagatt