Transcript: Human NM_033415.4

Homo sapiens armadillo repeat containing 6 (ARMC6), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-06-01
Taxon:
Homo sapiens (human)
Gene:
ARMC6 (93436)
Length:
2353
CDS:
375..1805

Additional Resources:

NCBI RefSeq record:
NM_033415.4
NBCI Gene record:
ARMC6 (93436)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_033415.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000129254 CGACGTGAAAGATGCTATTGT pLKO.1 1373 CDS 100% 5.625 7.875 N ARMC6 n/a
2 TRCN0000130155 CATTGTAAAGACGGCACCTAA pLKO.1 512 CDS 100% 4.950 3.465 N ARMC6 n/a
3 TRCN0000129190 CCCTTCACAATGAGAAGTGTT pLKO.1 1901 3UTR 100% 4.950 3.465 N ARMC6 n/a
4 TRCN0000129621 CATCATCTTCACTGCCTGGAA pLKO.1 713 CDS 100% 2.640 1.848 N ARMC6 n/a
5 TRCN0000129339 CCATGCCAAGATGATTGTGCA pLKO.1 1091 CDS 100% 2.640 1.848 N ARMC6 n/a
6 TRCN0000129211 CTCTGCTCCTTGTCTTTCTTA pLKO.1 2223 3UTR 100% 5.625 3.375 N ARMC6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_033415.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04602 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04602 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000476466 GTCCTCGCTTCACTGCGTAAACGG pLX_317 18% 100% 100% V5 n/a
Download CSV