Construct: ORF TRCN0000476563
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF015547.1_s317c1
- Derived from:
- ccsbBroadEn_09448
- DNA Barcode:
- CCTACGGACCTACATATGAATCTA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- IP6K3 (117283)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000476563
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 117283 | IP6K3 | inositol hexakisphosphate k... | NM_001142883.1 | 99.8% | 100% | 24C>T;165G>A |
2 | human | 117283 | IP6K3 | inositol hexakisphosphate k... | NM_054111.5 | 99.8% | 100% | 24C>T;165G>A |
3 | human | 117283 | IP6K3 | inositol hexakisphosphate k... | XM_005248842.3 | 99.8% | 100% | 24C>T;165G>A |
4 | human | 117283 | IP6K3 | inositol hexakisphosphate k... | XM_024446323.1 | 99.8% | 100% | 24C>T;165G>A |
5 | human | 117283 | IP6K3 | inositol hexakisphosphate k... | XM_024446324.1 | 99.8% | 100% | 24C>T;165G>A |
6 | human | 117283 | IP6K3 | inositol hexakisphosphate k... | XM_024446325.1 | 99.8% | 100% | 24C>T;165G>A |
7 | human | 117283 | IP6K3 | inositol hexakisphosphate k... | XM_005248843.4 | 69.1% | 65.7% | (many diffs) |
8 | human | 117283 | IP6K3 | inositol hexakisphosphate k... | XM_024446326.1 | 69.1% | 65.7% | (many diffs) |
9 | human | 117283 | IP6K3 | inositol hexakisphosphate k... | XM_024446327.1 | 69.1% | 65.7% | (many diffs) |
10 | human | 117283 | IP6K3 | inositol hexakisphosphate k... | XM_011514295.3 | 63.4% | 62.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1299
- ORF length:
- 1230
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggttgtgcaa aacagcgcag atgccgggga catgagggca ggcgtgcagc 121 tggagccctt cctgcaccag gtcggggggc acatgagcgt gatgaagtat gacgagcata 181 cggtgtgcaa gcccctcgtc tcccgggagc agaggttcta tgaatccctg ccactggcca 241 tgaagcggtt caccccacag tacaaaggta ccgtcacagt gcacctctgg aaagacagca 301 caggccatct cagcttggtt gccaacccag tgaaggagag ccaggagccc ttcaaggtct 361 ccacagagtc ggcggcggtg gccatatggc agacgctcca gcagaccacc ggcagcaatg 421 gcagcgactg cacccttgcc cagtggccgc atgcccagct ggcacgctca cccaaggaga 481 gcccggccaa ggctcttctg aggtccgagc cccacctcaa cactccagcc ttctcgctgg 541 tggaagacac caacggaaac caggttgaga ggaagagctt caacccgtgg ggcctgcaat 601 gccaccaggc ccacctgacc cgcctgtgct ccgagtaccc agagaacaag cggcatcggt 661 tcttgttgct ggaaaatgta gtgtcacagt acacgcatcc ctgtgtcctg gatctgaaga 721 tggggacccg gcagcacggc gatgatgcat cggaggagaa gaaggcccgc cacatgagga 781 agtgtgcgca gagcacctca gcctgcctgg gtgtgcgcat ctgcggcatg caggtttatc 841 aaacagataa gaagtacttt ctctgcaaag acaagtacta tggaagaaaa ctctcagtgg 901 aggggttcag acaagccctc tatcagttcc tacataatgg aagccacctc cggagggagc 961 tcctggagcc catcctgcac cagctccggg ccctcctcTC TGTCATTAGG AGCCAGAGTT 1021 CATACCGCTT CTATTCCAGC TCTCTCCTTG TCATCTATGA TGGGCAGGAA CCACCAGAAA 1081 GAGCCCCAGG CAGCCCGCAT CCTCACGAGG CTCCCCAGGC AGCCCACGGT AGCTCTCCCG 1141 GTGGTCTCAC CAAGGTTGAC ATCCGCATGA TTGACTTTGC TCATACCACA TACAAGGGCT 1201 ACTGGAATGA GCACACCACC TACGATGGAC CAGACCCTGG CTATATTTTT GGCCTGGAAA 1261 ACCTCATCAG GATCCTGCAG GATATCCAAG AGGGAGAATT GCCAACTTTC TTGTACAAAG 1321 TGGTTGATAT CGGTAAGCCT ATCCCTAACC CTCTCCTCGG TCTCGATTCT ACGTAGTAAT 1381 GAACTAGTCC GTAACTTGAA AGTATTTCGA TTTCTTGGCT TTATATATCT TGTGGAAAGG 1441 ACGACCTACG GACCTACATA TGAATCTAAC GCGTTAAGTC gacaatcaac ctctggatta 1501 caaaatttgt gaaagatt