Transcript: Human XM_024446324.1

PREDICTED: Homo sapiens inositol hexakisphosphate kinase 3 (IP6K3), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
IP6K3 (117283)
Length:
2965
CDS:
489..1721

Additional Resources:

NCBI RefSeq record:
XM_024446324.1
NBCI Gene record:
IP6K3 (117283)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001147242 GATGAAGTATGACGAGCATA pXPR_003 CGG 109 9% 5 0.6214 IP6K3 IP6K3 77655
2 BRDN0001147705 CGGTTCACCCCACAGTACAA pXPR_003 AGG 194 16% 5 0.5265 IP6K3 IP6K3 77656
3 BRDN0001147058 GCACGGCGATGATGCATCGG pXPR_003 AGG 682 55% 8 0.3585 IP6K3 IP6K3 77654
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024446324.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000037812 CTTTGCTCATACCACATACAA pLKO.1 1595 CDS 100% 5.625 7.875 N IP6K3 n/a
2 TRCN0000037813 CATCGGTTCTTGTTGCTGGAA pLKO.1 1074 CDS 100% 2.640 3.696 N IP6K3 n/a
3 TRCN0000194683 CCCTTAGATGTCTTCATAATA pLKO.1 1802 3UTR 100% 15.000 10.500 N IP6K3 n/a
4 TRCN0000197005 GACCAGACCCTGGCTATATTT pLKO.1 1648 CDS 100% 15.000 10.500 N IP6K3 n/a
5 TRCN0000196983 GCTCTCTCCTTGTCATCTATG pLKO.1 1459 CDS 100% 10.800 7.560 N IP6K3 n/a
6 TRCN0000037810 CCAGAGTTCATACCGCTTCTA pLKO.1 1433 CDS 100% 4.950 3.465 N IP6K3 n/a
7 TRCN0000037809 GCCCTCTATCAGTTCCTACAT pLKO.1 1335 CDS 100% 4.950 3.465 N IP6K3 n/a
8 TRCN0000197213 GTTCAGACAAGCCCTCTATCA pLKO.1 1325 CDS 100% 4.950 3.465 N IP6K3 n/a
9 TRCN0000037811 GCAGGTTTATCAAACAGATAA pLKO.1 1250 CDS 100% 1.320 0.924 N IP6K3 n/a
10 TRCN0000197084 GATGAAGTATGACGAGCATAC pLKO.1 581 CDS 100% 0.600 0.420 N IP6K3 n/a
11 TRCN0000197085 GTTGAGAGGAAGAGCTTCAAC pLKO.1 984 CDS 100% 0.495 0.347 N IP6K3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024446324.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488152 CATCATCGCTGCTACTGCGTTCAG pLX_317 25.3% 100% 100% V5 (not translated due to prior stop codon) n/a
2 TRCN0000488588 AAGGCGAAAAACGTTTTACAGCAA pLX_317 25.2% 99.9% 99.7% V5 1230_1231insG n/a
3 ccsbBroadEn_09448 pDONR223 100% 99.8% 100% None 24C>T;165G>A n/a
4 ccsbBroad304_09448 pLX_304 0% 99.8% 100% V5 24C>T;165G>A n/a
5 TRCN0000476563 CCTACGGACCTACATATGAATCTA pLX_317 24.8% 99.8% 100% V5 24C>T;165G>A n/a
6 ccsbBroadEn_15229 pDONR223 100% 97.4% 36.9% None (many diffs) n/a
7 ccsbBroad304_15229 pLX_304 0% 97.4% 36.9% V5 (not translated due to prior stop codon) (many diffs) n/a
8 TRCN0000480455 GCCGCCGATATCTCGACAAAGAAG pLX_317 28.7% 97.4% 36.9% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV