Construct: ORF TRCN0000476567
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF004227.1_s317c1
- Derived from:
- ccsbBroadEn_05535
- DNA Barcode:
- CCATTTTTTAGAGCTGGCGTGATC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TMEM179B (374395)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000476567
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 374395 | TMEM179B | transmembrane protein 179B | NM_199337.3 | 100% | 100% | |
| 2 | human | 374395 | TMEM179B | transmembrane protein 179B | NM_001363600.1 | 93.6% | 93.6% | 375_376ins42 |
| 3 | human | 374395 | TMEM179B | transmembrane protein 179B | NM_001363601.1 | 74.4% | 73% | (many diffs) |
| 4 | human | 374395 | TMEM179B | transmembrane protein 179B | NM_001363599.1 | 65.7% | 63.4% | 419_420ins79;432_433ins146 |
| 5 | mouse | 67706 | Tmem179b | transmembrane protein 179B | NM_026325.3 | 85.4% | 80.8% | (many diffs) |
| 6 | mouse | 67706 | Tmem179b | transmembrane protein 179B | NR_028419.1 | 60.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 723
- ORF length:
- 657
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc gctgtcctgg ctgcagcgcg tcgagcttgc gctctttgct gccgccttcc 121 tgtgcggggc cgtggcggcc gcggcgatga ctcggaccca gggctccttc agtggtagat 181 gtcccctgta tggtgtggcc accctgaatg gctcctccct ggccttatcc cgtccctcag 241 caccatccct gtgctacttt gtagctgggg cctctggcct cttggccctc tactgcctcc 301 tgcttttgct cttctggatc tacagcagct gcatcgagga ctcccacaga ggtgctatag 361 ggctgcgcat tgcactggcc atctcagcta tagccgtctt cctggtcttg gtgtctgcct 421 gtatccttcg atttggcacC AGGTCTCTCT GCAACTCCAT CATCTCCTTG AACACTACAA 481 TTAGCTGTTC TGAAGCCCAG AAAATTCCAT GGACACCCCC TGGAACTGCT CTGCAGTTTT 541 ACTCCAACCT ACACAATGCT GAAACCTCTT CTTGGGTGAA TTTGGTATTG TGGTGTGTGG 601 TCTTGGTGCT CCAGGTCGTG CAGTGGAAGT CTGAAGCCAC CCCATACCGG CCTCTGGAGA 661 GGGGTGACCC TGAGTGGAGC TCTGAGACAG ATGCTCTCGT TGGGTCACGC CTTTCCCATT 721 CCTGCCCAAC TTTCTTGTAC AAAGTGGTTG ATATCGGTAA GCCTATCCCT AACCCTCTCC 781 TCGGTCTCGA TTCTACGTAG TAATGAACTA GTCCGTAACT TGAAAGTATT TCGATTTCTT 841 GGCTTTATAT ATCTTGTGGA AAGGACGACC ATTTTTTAGA GCTGGCGTGA TCACGCGTTA 901 AGTCgacaat caacctctgg attacaaaat ttgtgaaaga tt