Construct: ORF TRCN0000476570
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF007427.1_s317c1
- Derived from:
- ccsbBroadEn_01371
- DNA Barcode:
- TGCTAGTGGTGCATGGCGCATGGA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- RALA (5898)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000476570
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 5898 | RALA | RAS like proto-oncogene A | NM_005402.4 | 100% | 100% | |
| 2 | human | 5898 | RALA | RAS like proto-oncogene A | XM_006715762.3 | 100% | 100% | |
| 3 | human | 5898 | RALA | RAS like proto-oncogene A | XM_011515466.1 | 100% | 100% | |
| 4 | mouse | 56044 | Rala | v-ral simian leukemia viral... | NM_019491.5 | 92.7% | 99.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 687
- ORF length:
- 618
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggctgcaaat aagcccaagg gtcagaattc tttggcttta cacaaagtca 121 tcatggtggg cagtggtggc gtgggcaagt cagctctgac tctacagttc atgtacgatg 181 agtttgtgga ggactatgag cctaccaaag cagacagcta tcggaagaag gtagtgctag 241 atggggagga agtccagatc gatatcttag atacagctgg gcaggaggac tacgctgcaa 301 ttagagacaa ctacttccga agtggggagg ggttcctctg tgttttctct attacagaaa 361 tggaaTCCTT TGCAGCTACA GCTGACTTCA GGGAGCAGAT TTTAAGAGTA AAAGAAGATG 421 AGAATGTTCC ATTTCTACTG GTTGGTAACA AATCAGATTT AGAAGATAAA AGACAGGTTT 481 CTGTAGAAGA GGCAAAAAAC AGAGCTGAGC AGTGGAATGT TAACTACGTG GAAACATCTG 541 CTAAAACACG AGCTAATGTT GACAAGGTAT TTTTTGATTT AATGAGAGAA ATTCGAGCGA 601 GAAAGATGGA AGACAGCAAA GAAAAGAATG GAAAAAAGAA GAGGAAAAGT TTAGCCAAGA 661 GAATCAGAGA AAGATGCTGC ATTTTATTGC CAACTTTCTT GTACAAAGTG GTTGATATCG 721 GTAAGCCTAT CCCTAACCCT CTCCTCGGTC TCGATTCTAC GTAGTAATGA ACTAGTCCGT 781 AACTTGAAAG TATTTCGATT TCTTGGCTTT ATATATCTTG TGGAAAGGAC GATGCTAGTG 841 GTGCATGGCG CATGGAACGC GTTAAGTCga caatcaacct ctggattaca aaatttgtga 901 aagatt