Transcript: Human NM_005402.4

Homo sapiens RAS like proto-oncogene A (RALA), mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
RALA (5898)
Length:
2787
CDS:
292..912

Additional Resources:

NCBI RefSeq record:
NM_005402.4
NBCI Gene record:
RALA (5898)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005402.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000004864 GCATGGTTGTTGCATATAGTT pLKO.1 1392 3UTR 100% 5.625 7.875 N RALA n/a
2 TRCN0000315073 AGGACTACGCTGCAATTAGAG pLKO_005 509 CDS 100% 4.950 6.930 N RALA n/a
3 TRCN0000315072 GGAGGAAGTCCAGATCGATAT pLKO_005 468 CDS 100% 10.800 8.640 N RALA n/a
4 TRCN0000315074 ATGGTTGTTGCATATAGTTAA pLKO_005 1394 3UTR 100% 13.200 9.240 N RALA n/a
5 TRCN0000004865 CGCTGCAATTAGAGACAACTA pLKO.1 516 CDS 100% 4.950 3.465 N RALA n/a
6 TRCN0000004867 CGGAAGAAGGTAGTGCTAGAT pLKO.1 445 CDS 100% 4.950 3.465 N RALA n/a
7 TRCN0000350484 CGGAAGAAGGTAGTGCTAGAT pLKO_005 445 CDS 100% 4.950 3.465 N RALA n/a
8 TRCN0000004868 CGATGAGTTTGTGGAGGACTA pLKO.1 399 CDS 100% 4.050 2.835 N RALA n/a
9 TRCN0000350408 CGATGAGTTTGTGGAGGACTA pLKO_005 399 CDS 100% 4.050 2.835 N RALA n/a
10 TRCN0000004866 CGAGCTAATGTTGACAAGGTA pLKO.1 772 CDS 100% 3.000 2.100 N RALA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005402.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01371 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01371 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000476570 TGCTAGTGGTGCATGGCGCATGGA pLX_317 51.7% 100% 100% V5 n/a
Download CSV