Construct: ORF TRCN0000476572
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF017956.1_s317c1
- Derived from:
- ccsbBroadEn_05170
- DNA Barcode:
- TGGACTGTGAATTGGGTCTTGCCC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- IMMP1L (196294)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000476572
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 196294 | IMMP1L | inner mitochondrial membran... | NM_001304274.2 | 100% | 100% | |
| 2 | human | 196294 | IMMP1L | inner mitochondrial membran... | NM_144981.3 | 100% | 100% | |
| 3 | human | 196294 | IMMP1L | inner mitochondrial membran... | XM_005252812.3 | 100% | 100% | |
| 4 | human | 196294 | IMMP1L | inner mitochondrial membran... | XM_011519942.1 | 100% | 100% | |
| 5 | human | 196294 | IMMP1L | inner mitochondrial membran... | XM_011519943.2 | 100% | 100% | |
| 6 | human | 196294 | IMMP1L | inner mitochondrial membran... | XM_011519944.2 | 100% | 100% | |
| 7 | human | 196294 | IMMP1L | inner mitochondrial membran... | XM_011519945.2 | 100% | 100% | |
| 8 | human | 196294 | IMMP1L | inner mitochondrial membran... | XM_011519946.2 | 100% | 100% | |
| 9 | human | 196294 | IMMP1L | inner mitochondrial membran... | XM_011519947.2 | 100% | 100% | |
| 10 | human | 196294 | IMMP1L | inner mitochondrial membran... | XM_017017305.1 | 100% | 100% | |
| 11 | human | 196294 | IMMP1L | inner mitochondrial membran... | XM_017017306.1 | 69.5% | 59.7% | (many diffs) |
| 12 | human | 196294 | IMMP1L | inner mitochondrial membran... | XM_017017307.1 | 66.6% | 65.6% | (many diffs) |
| 13 | human | 196294 | IMMP1L | inner mitochondrial membran... | XR_242781.3 | 51% | 1_155del;477_624del;712_713ins89 | |
| 14 | mouse | 66541 | Immp1l | IMP1 inner mitochondrial me... | NM_028260.2 | 91.5% | 93.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 567
- ORF length:
- 498
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcactat gcttcgtggt gttctgggga aaacctttcg acttgttggc tatactattc 121 aatatggctg tatagctcat tgtgcttttg aatacgttgg tggtgttgtc atgtgttctg 181 gaccatcaat ggagcctaca attcaaaatt cagatattgt ctttgcagaa aatcttagtc 241 gacattttta tggtatccaa agaggtgaca ttgtgattgc aaaaagccca agtgatccaa 301 aatcaaatat ttgtaaaaga gtaattggtt tggaaggaga caaaatcctc accactagtc 361 catcagattt ctttaaaagc catagttatg tgccaatggg tcatgtttgg ttagaaggtg 421 acaatcTACA GAATTCTACA GATTCCAGGT GCTATGGACC TATTCCATAT GGACTAATAA 481 GAGGACGAAT CTTCTTTAAG ATTTGGCCTC TGAGTGATTT TGGATTTTTA CGTGCCAGCC 541 CTAATGGCCA CAGATTTTCT GATGATTTGC CAACTTTCTT GTACAAAGTG GTTGATATCG 601 GTAAGCCTAT CCCTAACCCT CTCCTCGGTC TCGATTCTAC GTAGTAATGA ACTAGTCCGT 661 AACTTGAAAG TATTTCGATT TCTTGGCTTT ATATATCTTG TGGAAAGGAC GATGGACTGT 721 GAATTGGGTC TTGCCCACGC GTTAAGTCga caatcaacct ctggattaca aaatttgtga 781 aagatt