Construct: ORF TRCN0000476648
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF014140.1_s317c1
- Derived from:
- ccsbBroadEn_10203
- DNA Barcode:
- TAAGCCTACCTAATCGAACGTGCC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- RELL1 (768211)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000476648
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 768211 | RELL1 | RELT like 1 | NM_001085399.2 | 99.8% | 100% | 387G>A |
| 2 | human | 768211 | RELL1 | RELT like 1 | NM_001085400.2 | 99.8% | 100% | 387G>A |
| 3 | human | 768211 | RELL1 | RELT like 1 | XR_002959758.1 | 74.1% | (many diffs) | |
| 4 | human | 768211 | RELL1 | RELT like 1 | XM_017008590.2 | 53% | 52.3% | 0_1ins379;4_5insAG;6G>A |
| 5 | mouse | 100532 | Rell1 | RELT-like 1 | NM_145923.4 | 81.9% | 87.8% | (many diffs) |
| 6 | mouse | 100532 | Rell1 | RELT-like 1 | XM_006503621.3 | 81.9% | 87.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 882
- ORF length:
- 813
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggctccgcgg gcactcccgg ggtccgccgt cctagccgct gctgtcttcg 121 tgggaggcgc cgtgagttcg ccgctggtgg ctccggacaa tgggagcagc cgcacattgc 181 actccagaac agagacgacc ccgtcgccca gcaacgatac tgggaatgga cacccagaat 241 atattgcata cgcgcttgtc cctgtgttct ttatcatggg tctctttggc gtcctcattt 301 gccacctgct taagaagaaa ggctatcgtt gtacaacaga agcagagcaa gatatcgaag 361 aggaaaaggt tgaaaagata gaattgaatg acagtgtgaa tgaaaacagt gacactgttg 421 ggcaaatcgt ccactacatc atgaaaaatg aagcaaatgc tgatgtctta aaggcgatgg 481 tagcagataa cagcctgtat gatccTGAAA GCCCCGTGAC CCCCAGCACA CCAGGGAGCC 541 CGCCAGTGAG TCCTGGGCCT TTGTCACCAG GGGGGACGCC AGGGAAGCAC GTCTGTGGCC 601 ATCATCTGCA TACGGTGGGC GGTGTTGTCG AGAGGGATGT GTGTCATCGG TGTAGGCACA 661 AGCGGTGGCA CTTTATAAAG CCCACTAACA AGTCCAGAGA GAGCAGACCA CGGCGCCAAG 721 GCGAGGTCAC GGTCCTTTCT GTTGGCAGAT TTAGAGTTAC AAAAGTGGAG CACAAGTCAA 781 ACCAGAAGGA ACGGAGAAGC CTGATGTCTG TTAGTGGGGC TGAAACCGTC AATGGGGAGG 841 TGCCGGCAAC ACCTGTGAAG AGAGAACGCA GTGGCACAGA GTTGCCAACT TTCTTGTACA 901 AAGTGGTTGA TATCGGTAAG CCTATCCCTA ACCCTCTCCT CGGTCTCGAT TCTACGTAGT 961 AATGAACTAG TCCGTAACTT GAAAGTATTT CGATTTCTTG GCTTTATATA TCTTGTGGAA 1021 AGGACGATAA GCCTACCTAA TCGAACGTGC CACGCGTTAA GTCgacaatc aacctctgga 1081 ttacaaaatt tgtgaaagat t