Transcript: Human XM_017008590.2

PREDICTED: Homo sapiens RELT like 1 (RELL1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RELL1 (768211)
Length:
3772
CDS:
626..1060

Additional Resources:

NCBI RefSeq record:
XM_017008590.2
NBCI Gene record:
RELL1 (768211)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017008590.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000262640 GAATGGACACCCAGAATATAT pLKO_005 240 5UTR 100% 15.000 10.500 N RELL1 n/a
2 TRCN0000262639 CGCTTGTCCCTGTGTTCTTTA pLKO_005 269 5UTR 100% 13.200 9.240 N RELL1 n/a
3 TRCN0000262638 CAGTGACACTGTTGGGCAAAT pLKO_005 423 5UTR 100% 10.800 7.560 N RELL1 n/a
4 TRCN0000116227 CCTCCCAAAGTTCTGGGATTA pLKO.1 2467 3UTR 100% 1.080 0.540 Y ELOVL7 n/a
5 TRCN0000164591 CCTCCCAAAGTTCTGGGATTA pLKO.1 2467 3UTR 100% 1.080 0.540 Y TNNI1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017008590.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10203 pDONR223 100% 53% 52.3% None 0_1ins379;4_5insAG;6G>A n/a
2 ccsbBroad304_10203 pLX_304 0% 53% 52.3% V5 0_1ins379;4_5insAG;6G>A n/a
3 TRCN0000476648 TAAGCCTACCTAATCGAACGTGCC pLX_317 46.2% 53% 52.3% V5 0_1ins379;4_5insAG;6G>A n/a
Download CSV