Construct: ORF TRCN0000476708
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF010218.1_s317c1
- Derived from:
- ccsbBroadEn_10168
- DNA Barcode:
- ATATGATCGACATCCCCTATCGAG
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Early stop codon detected
Originally Annotated References:
- Gene:
- AARD (441376)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000476708
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 441376 | AARD | alanine and arginine rich d... | NM_001025357.3 | 99.5% | 98.7% | 286G>C;463G>T |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 531
- ORF length:
- 462
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gggccccggg gacttccgcc gctgcagaga gagaatttcc caggggctcc 121 agggactccc aggtagagcg gagctttggt tcccacctcg tcccgcgtgc gacttcttcg 181 gggacggcag gagcacggac atccaggagg aggccctcgc cgccagcccg ctgctggagg 241 acctcagacg acggctgacg cgcgccttcc agtgggcggt gcagcgcgcg atctcgaggc 301 gcgtgcagga ggcggcggcg gcggcggcgg cgcgggagga gcagagctgg acgcgcgttg 361 aggccaccct ggccaggctg cgggcggagc TGGTGGAAAT GCATTTCCAA AACCACCAGC 421 TGGCTAGAAC TTTACTGGAC CTAAACATGA AAGTGCAGCA ATTGAAAAAG GAGTATGAAC 481 TGGAAATTAC ATCAGACTCC CAAAGCCCAA AAGATGATGC TGCGAATCCG TAATTGCCAA 541 CTTTCTTGTA CAAAGTGGTT GATATCGGTA AGCCTATCCC TAACCCTCTC CTCGGTCTCG 601 ATTCTACGTA GTAATGAACT AGTCCGTAAC TTGAAAGTAT TTCGATTTCT TGGCTTTATA 661 TATCTTGTGG AAAGGACGAA TATGATCGAC ATCCCCTATC GAGACGCGTT AAGTCgacaa 721 tcaacctctg gattacaaaa tttgtgaaag att