Transcript: Human NM_001025357.3

Homo sapiens alanine and arginine rich domain containing protein (AARD), mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
AARD (441376)
Length:
2291
CDS:
38..505

Additional Resources:

NCBI RefSeq record:
NM_001025357.3
NBCI Gene record:
AARD (441376)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001025357.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000146322 CTAGAACTTTACTGGACCTAA pLKO.1 393 CDS 100% 4.950 6.930 N AARD n/a
2 TRCN0000149340 GCTAGAACTTTACTGGACCTA pLKO.1 392 CDS 100% 2.640 3.696 N AARD n/a
3 TRCN0000147305 GAACTTTACTGGACCTAAACA pLKO.1 396 CDS 100% 5.625 3.938 N AARD n/a
4 TRCN0000122223 GAAATTACATCAGACTCCCAA pLKO.1 452 CDS 100% 2.640 1.848 N AARD n/a
5 TRCN0000122476 CATCCTGGCTAACACTGTGAA pLKO.1 606 3UTR 100% 4.950 2.475 Y AARD n/a
6 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 542 3UTR 100% 4.950 2.475 Y ERAP2 n/a
7 TRCN0000138140 GATTGAGACCATCCTGGCTAA pLKO.1 597 3UTR 100% 4.050 2.025 Y LOC441087 n/a
8 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 543 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001025357.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10168 pDONR223 100% 99.5% 98.7% None 286G>C;463G>T n/a
2 ccsbBroad304_10168 pLX_304 0% 99.5% 98.7% V5 (not translated due to prior stop codon) 286G>C;463G>T n/a
3 TRCN0000476708 ATATGATCGACATCCCCTATCGAG pLX_317 31.5% 99.5% 98.7% V5 (not translated due to prior stop codon) 286G>C;463G>T n/a
Download CSV