Construct: ORF TRCN0000476761
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF004591.1_s317c1
- Derived from:
- ccsbBroadEn_04038
- DNA Barcode:
- GTGGTGCCTATACTTGCACTACTG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- ELOVL6 (79071)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000476761
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 79071 | ELOVL6 | ELOVL fatty acid elongase 6 | NM_001130721.2 | 100% | 100% | |
2 | human | 79071 | ELOVL6 | ELOVL fatty acid elongase 6 | NM_024090.3 | 100% | 100% | |
3 | human | 79071 | ELOVL6 | ELOVL fatty acid elongase 6 | XM_011532233.3 | 100% | 100% | |
4 | human | 79071 | ELOVL6 | ELOVL fatty acid elongase 6 | XM_011532234.3 | 100% | 100% | |
5 | mouse | 170439 | Elovl6 | ELOVL family member 6, elon... | NM_130450.2 | 92.5% | 96.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 861
- ORF length:
- 795
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgaa catgtcagtg ttgactttac aagaatatga attcgaaaag cagttcaacg 121 agaatgaagc catccaatgg atgcaggaaa actggaagaa atctttcctg ttttctgctc 181 tgtatgctgc ctttatattc ggtggtcggc acctaatgaa taaacgagca aagtttgaac 241 tgaggaagcc attagtgctc tggtctctga cccttgcagt cttcagtata ttcggtgctc 301 ttcgaactgg tgcttatatg gtgtacattt tgatgaccaa aggcctgaag cagtcagttt 361 gtgaccaggg tttttacaat ggacctgtca gcaaattctg ggcttatgca tttgtgctaa 421 gcaaagcacc cgaactagga gatacaatat tcattattct gaggaagcag aagctgatct 481 tcctgcactg gtatcaccac atcactgtgc tcctgtactc ttggtactcc tacaaagaca 541 tggttGCCGG GGGAGGTTGG TTCATGACTA TGAACTATGG CGTGCACGCC GTGATGTACT 601 CTTACTATGC CTTGCGGGCG GCAGGTTTCC GAGTCTCCCG GAAGTTTGCC ATGTTCATCA 661 CCTTGTCCCA GATCACTCAG ATGCTGATGG GCTGTGTGGT TAACTACCTG GTCTTCTGCT 721 GGATGCAGCA TGACCAGTGT CACTCTCACT TTCAGAACAT CTTCTGGTCC TCACTCATGT 781 ACCTCAGCTA CCTTGTGCTC TTCTGCCATT TCTTCTTTGA GGCCTACATC GGCAAAATGA 841 GGAAAACAAC GAAAGCTGAA TACCCAACTT TCTTGTACAA AGTGGTTGAT ATCGGTAAGC 901 CTATCCCTAA CCCTCTCCTC GGTCTCGATT CTACGTAGTA ATGAACTAGT CCGTAACTTG 961 AAAGTATTTC GATTTCTTGG CTTTATATAT CTTGTGGAAA GGACGAGTGG TGCCTATACT 1021 TGCACTACTG ACGCGTTAAG TCgacaatca acctctggat tacaaaattt gtgaaagatt