Transcript: Mouse NM_130450.2

Mus musculus ELOVL family member 6, elongation of long chain fatty acids (yeast) (Elovl6), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Elovl6 (170439)
Length:
5951
CDS:
143..946

Additional Resources:

NCBI RefSeq record:
NM_130450.2
NBCI Gene record:
Elovl6 (170439)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_130450.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000175486 CATTAACTACCTGGTCTTCAA pLKO.1 775 CDS 100% 4.950 6.930 N Elovl6 n/a
2 TRCN0000345535 CATTAACTACCTGGTCTTCAA pLKO_005 775 CDS 100% 4.950 6.930 N Elovl6 n/a
3 TRCN0000345538 CCCGGAAGTTTGCCATGTTCA pLKO_005 714 CDS 100% 4.950 6.930 N Elovl6 n/a
4 TRCN0000176303 CCCATGTAGATCAAGTCATAA pLKO.1 3008 3UTR 100% 13.200 9.240 N Elovl6 n/a
5 TRCN0000217465 GTCAGCAAATTCTGGGCTTAT pLKO.1 464 CDS 100% 10.800 7.560 N Elovl6 n/a
6 TRCN0000173809 CCATCCAATGGATGCAGGAAA pLKO.1 207 CDS 100% 4.950 3.465 N Elovl6 n/a
7 TRCN0000345534 CCATCCAATGGATGCAGGAAA pLKO_005 207 CDS 100% 4.950 3.465 N Elovl6 n/a
8 TRCN0000193108 CTGTACATTCTGATGACCAAA pLKO.1 398 CDS 100% 4.950 3.465 N Elovl6 n/a
9 TRCN0000163912 CCAGATCACTCAGATGCTGAT pLKO.1 745 CDS 100% 4.050 2.835 N ELOVL6 n/a
10 TRCN0000278465 CCAGATCACTCAGATGCTGAT pLKO_005 745 CDS 100% 4.050 2.835 N ELOVL6 n/a
11 TRCN0000173581 GCTGTCTTTATGAGACCGATT pLKO.1 4257 3UTR 100% 4.050 2.835 N Elovl6 n/a
12 TRCN0000193521 GATATTCATCATTCTGAGGAA pLKO.1 523 CDS 100% 2.640 1.848 N Elovl6 n/a
13 TRCN0000345536 ATGTACTCTTACTACGCCTTG pLKO_005 671 CDS 100% 2.250 1.575 N Elovl6 n/a
14 TRCN0000345537 ACTGGATGCAGCATGACAACG pLKO_005 795 CDS 100% 4.050 2.430 N Elovl6 n/a
15 TRCN0000166364 CACACACACACACACACACAA pLKO.1 1394 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_130450.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04038 pDONR223 100% 92.5% 96.2% None (many diffs) n/a
2 ccsbBroad304_04038 pLX_304 0% 92.5% 96.2% V5 (many diffs) n/a
3 TRCN0000476761 GTGGTGCCTATACTTGCACTACTG pLX_317 40% 92.5% 96.2% V5 (many diffs) n/a
Download CSV