Construct: ORF TRCN0000476848
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF011462.1_s317c1
- Derived from:
- ccsbBroadEn_03517
- DNA Barcode:
- CCCCCTGCACACGTTATCCCTTTC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TMEM45A (55076)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000476848
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 55076 | TMEM45A | transmembrane protein 45A | NM_018004.3 | 100% | 100% | |
| 2 | human | 55076 | TMEM45A | transmembrane protein 45A | XM_024453614.1 | 100% | 100% | |
| 3 | human | 55076 | TMEM45A | transmembrane protein 45A | XM_024453615.1 | 100% | 100% | |
| 4 | human | 55076 | TMEM45A | transmembrane protein 45A | NM_001363876.2 | 94.5% | 94.5% | 1_48del |
| 5 | human | 55076 | TMEM45A | transmembrane protein 45A | XM_005247569.2 | 94.5% | 94.5% | 1_48del |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 891
- ORF length:
- 825
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggg gaatttcaga ggtcatgccc tccctggaac cttctttttt attattggtc 121 tttggtggtg tacaaagagt attctgaagt atatctgcaa aaagcaaaag cgaacctgct 181 atcttggttc caaaacatta ttctatcgat tggaaatttt ggagggaatt acaatagttg 241 gcatggcttt aactggcatg gctggggagc agtttattcc tggagggccc catctgatgt 301 tatatgacta taaacaaggt cactggaatc aactcctggg ctggcatcat ttcaccatgt 361 atttcttctt tgggctgttg ggtgtggcag atatcttatg tttcaccatc agttcacttc 421 ctgtgtcctt aaccaagtta atgttgtcaa atgccTTATT TGTGGAGGCC TTTATCTTCT 481 ACAACCACAC TCATGGCCGG GAAATGCTGG ACATCTTTGT GCACCAGCTG CTGGTTTTGG 541 TCGTCTTTCT GACAGGCCTC GTTGCCTTCC TAGAGTTCCT TGTTCGGAAC AATGTACTTC 601 TGGAGCTATT GCGGTCAAGT CTCATTCTGC TTCAGGGGAG CTGGTTCTTT CAGATTGGAT 661 TTGTCCTGTA TCCCCCCAGT GGAGGTCCTG CATGGGATCT GATGGATCAT GAAAATATTT 721 TGTTTCTCAC CATATGCTTT TGTTGGCATT ATGCAGTAAC CATTGTCATC GTTGGAATGA 781 ATTATGCTTT CATTACCTGG TTGGTTAAAT CTAGACTTAA GAGGCTCTGC TCCTCAGAAG 841 TTGGACTTCT GAAAAATGCT GAACGAGAAC AAGAATCAGA AGAAGAAATG TGCCCAACTT 901 TCTTGTACAA AGTGGTTGAT ATCGGTAAGC CTATCCCTAA CCCTCTCCTC GGTCTCGATT 961 CTACGTAGTA ATGAACTAGT CCGTAACTTG AAAGTATTTC GATTTCTTGG CTTTATATAT 1021 CTTGTGGAAA GGACGACCCC CTGCACACGT TATCCCTTTC ACGCGTTAAG TCgacaatca 1081 acctctggat tacaaaattt gtgaaagatt