Transcript: Human NM_018004.3

Homo sapiens transmembrane protein 45A (TMEM45A), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
TMEM45A (55076)
Length:
1567
CDS:
314..1141

Additional Resources:

NCBI RefSeq record:
NM_018004.3
NBCI Gene record:
TMEM45A (55076)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_018004.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000148458 CCTGTGTCCTTAACCAAGTTA pLKO.1 668 CDS 100% 5.625 3.938 N TMEM45A n/a
2 TRCN0000344156 CCTGTGTCCTTAACCAAGTTA pLKO_005 668 CDS 100% 5.625 3.938 N TMEM45A n/a
3 TRCN0000146590 CTGGTTCTTTCAGATTGGATT pLKO.1 889 CDS 100% 4.950 3.465 N TMEM45A n/a
4 TRCN0000147692 GATGACTCTAAGTGTACTGTT pLKO.1 1240 3UTR 100% 4.950 3.465 N TMEM45A n/a
5 TRCN0000344105 GATGACTCTAAGTGTACTGTT pLKO_005 1240 3UTR 100% 4.950 3.465 N TMEM45A n/a
6 TRCN0000130366 GCAGTAACCATTGTCATCGTT pLKO.1 1001 CDS 100% 3.000 2.100 N TMEM45A n/a
7 TRCN0000352975 GCAGTAACCATTGTCATCGTT pLKO_005 1001 CDS 100% 3.000 2.100 N TMEM45A n/a
8 TRCN0000149328 GCTTTCATTACCTGGTTGGTT pLKO.1 1034 CDS 100% 3.000 2.100 N TMEM45A n/a
9 TRCN0000130322 GAGTTCCTTGTTCGGAACAAT pLKO.1 821 CDS 100% 0.563 0.394 N TMEM45A n/a
10 TRCN0000344103 GAGTTCCTTGTTCGGAACAAT pLKO_005 821 CDS 100% 0.563 0.394 N TMEM45A n/a
11 TRCN0000147380 GAACGAGAACAAGAATCAGAA pLKO.1 1109 CDS 100% 4.950 2.970 N TMEM45A n/a
12 TRCN0000344157 GAACGAGAACAAGAATCAGAA pLKO_005 1109 CDS 100% 4.950 2.970 N TMEM45A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018004.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03517 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03517 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000476848 CCCCCTGCACACGTTATCCCTTTC pLX_317 52.7% 100% 100% V5 n/a
Download CSV