Construct: ORF TRCN0000476922
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF017686.1_s317c1
- Derived from:
- ccsbBroadEn_09975
- DNA Barcode:
- GACGCCAGACAATTCTTAGCAGGG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- RABL3 (285282)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000476922
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 285282 | RABL3 | RAB, member of RAS oncogene... | NM_173825.5 | 99.7% | 99.1% | 179A>G;488G>C |
| 2 | human | 285282 | RABL3 | RAB, member of RAS oncogene... | NM_001363965.1 | 94.1% | 93.6% | 179A>G;488G>C;645_686del |
| 3 | human | 285282 | RABL3 | RAB, member of RAS oncogene... | NM_001363964.1 | 89.5% | 88.9% | 179A>G;488G>C;533_534ins72 |
| 4 | human | 285282 | RABL3 | RAB, member of RAS oncogene... | NR_157022.1 | 16.9% | (many diffs) | |
| 5 | mouse | 67657 | Rabl3 | RAB, member RAS oncogene fa... | NM_001042499.1 | 88.8% | 91.5% | (many diffs) |
| 6 | mouse | 67657 | Rabl3 | RAB, member RAS oncogene fa... | XR_384595.1 | 28.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 777
- ORF length:
- 708
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggcgtccctg gatcgggtga aggtactggt gttgggagac tcaggtgttg 121 ggaaatcttc gttagtccat ctcctatgcc aaaatcaagt gctgggaaat ccatcatgga 181 ctgtgggctg ctcagtggat gtcagagttc atgattacaa agaaggaacc ccagaagaga 241 agacctgcta catagaatta tgggatgttg gaggctctgt gggcagtgcc agcagcgtga 301 aaagcacaag agcagtattc tacaactccg taaatggtat tattttcgta cacgacttaa 361 caaataagaa gtcctcccaa aacttgcgtc gttggtcatt ggaagctctc aacagggatt 421 tggtgccaac tGGAGTCTTG GTGACAAATG GGGATTATGA TCAAGAACAG TTTGCTGATA 481 ACCAAATACC ACTGTTGGTA ATAGGGACTA AACTGGACCA GATTCATGAA ACAAAGCGCC 541 ATGAAGTTTT AACTACGACT GCTTTCCTGG CTGAGGATTT CAATCCAGAA GAAATTAATT 601 TGGACTGCAC AAATCCACGG TACTTAGCTG CAGGTTCTTC CAATGCTGTC AAGCTCAGTA 661 GGTTTTTTGA TAAGGTCATA GAGAAGAGAT ACTTTTTAAG AGAAGGTAAT CAGATTCCAG 721 GCTTTCCTGA TCGGAAAAGA TTTGGGGCAG GAACATTAAA GAGCCTTCAT TATGACTTGC 781 CAACTTTCTT GTACAAAGTG GTTGATATCG GTAAGCCTAT CCCTAACCCT CTCCTCGGTC 841 TCGATTCTAC GTAGTAATGA ACTAGTCCGT AACTTGAAAG TATTTCGATT TCTTGGCTTT 901 ATATATCTTG TGGAAAGGAC GAGACGCCAG ACAATTCTTA GCAGGGACGC GTTAAGTCga 961 caatcaacct ctggattaca aaatttgtga aagatt