Transcript: Human NM_001363965.1

Homo sapiens RAB, member of RAS oncogene family like 3 (RABL3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-15
Taxon:
Homo sapiens (human)
Gene:
RABL3 (285282)
Length:
4068
CDS:
174..926

Additional Resources:

NCBI RefSeq record:
NM_001363965.1
NBCI Gene record:
RABL3 (285282)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001363965.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000021301 CGTACACGACTTAACAAATAA pLKO.1 452 CDS 100% 15.000 21.000 N RABL3 n/a
2 TRCN0000021302 CTGTTGGTAATAGGGACTAAA pLKO.1 597 CDS 100% 13.200 18.480 N RABL3 n/a
3 TRCN0000432345 CCTTCAGCCTTACCCTTTAAT pLKO_005 1041 3UTR 100% 15.000 10.500 N RABL3 n/a
4 TRCN0000427132 CAGTTTGCTGATAACCAAATA pLKO_005 573 CDS 100% 13.200 9.240 N RABL3 n/a
5 TRCN0000412498 GATGTCAGAGTTCATGATTAC pLKO_005 303 CDS 100% 10.800 7.560 N RABL3 n/a
6 TRCN0000021303 GCTGTCAAGCTCAGTAGGTTT pLKO.1 750 CDS 100% 4.950 3.465 N RABL3 n/a
7 TRCN0000021300 GCTGAGGATTTCAATCCAGAA pLKO.1 675 CDS 100% 4.050 2.835 N RABL3 n/a
8 TRCN0000021299 GCAGTATTCTACAACTCCGTA pLKO.1 417 CDS 100% 2.640 1.848 N RABL3 n/a
9 TRCN0000084008 CGCCTATAATCCCAGCACTTT pLKO.1 3321 3UTR 100% 4.950 2.475 Y NPHS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001363965.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09975 pDONR223 100% 94.1% 93.6% None 179A>G;488G>C;645_686del n/a
2 ccsbBroad304_09975 pLX_304 0% 94.1% 93.6% V5 179A>G;488G>C;645_686del n/a
3 TRCN0000476922 GACGCCAGACAATTCTTAGCAGGG pLX_317 48.7% 94.1% 93.6% V5 179A>G;488G>C;645_686del n/a
Download CSV