Construct: ORF TRCN0000476966
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF012751.1_s317c1
- Derived from:
- ccsbBroadEn_05883
- DNA Barcode:
- AATGATCTGGACGGGCACGTAACA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- BCL7A (605)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000476966
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 605 | BCL7A | BAF chromatin remodeling co... | NM_001024808.3 | 100% | 100% | |
2 | human | 605 | BCL7A | BAF chromatin remodeling co... | NM_020993.5 | 90.9% | 90.9% | 561_623del |
3 | mouse | 77045 | Bcl7a | B cell CLL/lymphoma 7A | NM_029850.3 | 89.6% | 94.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 699
- ORF length:
- 630
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gtcgggcagg tcggttcgag ccgagacgag gagccgggcc aaagatgata 121 tcaagagggt catggcggcg atcgagaaag tgcgcaaatg ggagaagaaa tgggtgaccg 181 ttggtgacac atccctacga atctacaaat gggtccctgt gacggagccc aaggttgatg 241 acaaaaacaa gaataagaaa aaaggcaagg acgagaagtg tggctcagag gtgaccactc 301 cggagaacag ttcctcccca gggatgatgg acatgcatga cgataacagc aaccagagct 361 ccatcgcaga tgccTCCCCC ATCAAACAGG AGAACAGCAG CAACTCCAGC CCCGCTCCAG 421 AGCCCAACTC GGCTGTGCCC AGCGACGGCA CCGAGGCCAA GGTGGATGAG GCCCAGGCTG 481 ATGGGAAGGA GCACCCAGGA GCTGAAGATG CTTCTGATGA GCAGAATTCA CAGTCCTCGA 541 TGGAACATTC GATGAACAGC TCAGAGAAAG TAGATCGGCA GCCGTCTGGA GACTCGGGTC 601 TGGCCGCAGA GACGTCTGCA ATCTCTCAGG ATTTGGAAGG AGTGCCACCC TCTAAAAAGA 661 TGAAACTGGA GGCCTCTCAA CAAAACTCCG AAGAGATGTT GCCAACTTTC TTGTACAAAG 721 TGGTTGATAT CGGTAAGCCT ATCCCTAACC CTCTCCTCGG TCTCGATTCT ACGTAGTAAT 781 GAACTAGTCC GTAACTTGAA AGTATTTCGA TTTCTTGGCT TTATATATCT TGTGGAAAGG 841 ACGAAATGAT CTGGACGGGC ACGTAACAAC GCGTTAAGTC gacaatcaac ctctggatta 901 caaaatttgt gaaagatt