Transcript: Human NM_001024808.3

Homo sapiens BAF chromatin remodeling complex subunit BCL7A (BCL7A), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-10
Taxon:
Homo sapiens (human)
Gene:
BCL7A (605)
Length:
3722
CDS:
209..841

Additional Resources:

NCBI RefSeq record:
NM_001024808.3
NBCI Gene record:
BCL7A (605)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001024808.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000033519 CATCCCTACGAATCTACAAAT pLKO.1 330 CDS 100% 13.200 18.480 N BCL7A n/a
2 TRCN0000033522 GATGGACATGCATGACGATAA pLKO.1 466 CDS 100% 10.800 15.120 N BCL7A n/a
3 TRCN0000262911 AGATGTAGACGATGCTTTAAA pLKO_005 834 CDS 100% 15.000 10.500 N BCL7A n/a
4 TRCN0000262913 GAAGGAGTGCCACCCTCTAAA pLKO_005 776 CDS 100% 13.200 9.240 N BCL7A n/a
5 TRCN0000262912 TTCTCTATGTAACGATATAAG pLKO_005 1156 3UTR 100% 13.200 9.240 N BCL7A n/a
6 TRCN0000262914 ATGAAACTGGAGGCCTCTCAA pLKO_005 800 CDS 100% 4.950 3.465 N BCL7A n/a
7 TRCN0000033523 GAGCCCAAGGTTGATGACAAA pLKO.1 365 CDS 100% 4.950 3.465 N BCL7A n/a
8 TRCN0000033521 CCTCGATGGAACATTCGATGA pLKO.1 675 CDS 100% 4.050 2.835 N BCL7A n/a
9 TRCN0000033520 GAGAAGAAATGGGTGACCGTT pLKO.1 302 CDS 100% 2.640 1.848 N BCL7A n/a
10 TRCN0000282464 ATGATATCAAGAGGGTCATGG pLKO_005 255 CDS 100% 4.050 2.430 N BCL7A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001024808.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05883 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05883 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000476966 AATGATCTGGACGGGCACGTAACA pLX_317 51.3% 100% 100% V5 n/a
4 ccsbBroadEn_00157 pDONR223 100% 90.7% 90.9% None 560_561ins63;565T>C n/a
5 ccsbBroad304_00157 pLX_304 0% 90.7% 90.9% V5 560_561ins63;565T>C n/a
6 TRCN0000467663 ATCGCTGTCAGTAATTCTTAAACC pLX_317 48% 90.7% 90.9% V5 560_561ins63;565T>C n/a
Download CSV