Construct: ORF TRCN0000477025
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF004635.1_s317c1
- Derived from:
- ccsbBroadEn_03768
- DNA Barcode:
- CTTCCAGTTAGACTACCGGGTCCG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CHPT1 (56994)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000477025
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 56994 | CHPT1 | choline phosphotransferase 1 | NM_020244.3 | 100% | 100% | |
| 2 | human | 56994 | CHPT1 | choline phosphotransferase 1 | XM_011538574.1 | 89.1% | 89.1% | 648_649ins132 |
| 3 | human | 56994 | CHPT1 | choline phosphotransferase 1 | XR_245946.2 | 74.7% | 1_190del;1365_1457del;1502_1629del | |
| 4 | human | 56994 | CHPT1 | choline phosphotransferase 1 | XR_001748818.1 | 66.5% | (many diffs) | |
| 5 | human | 56994 | CHPT1 | choline phosphotransferase 1 | XR_002957362.1 | 57.7% | (many diffs) | |
| 6 | human | 56994 | CHPT1 | choline phosphotransferase 1 | XM_011538575.1 | 54.9% | 54.6% | (many diffs) |
| 7 | human | 56994 | CHPT1 | choline phosphotransferase 1 | XR_001748816.1 | 42.8% | (many diffs) | |
| 8 | human | 56994 | CHPT1 | choline phosphotransferase 1 | XR_001748817.1 | 18.4% | (many diffs) | |
| 9 | mouse | 212862 | Chpt1 | choline phosphotransferase 1 | NM_001146690.1 | 89.3% | 89.4% | (many diffs) |
| 10 | mouse | 212862 | Chpt1 | choline phosphotransferase 1 | NM_144807.3 | 86.8% | 86.6% | (many diffs) |
| 11 | mouse | 212862 | Chpt1 | choline phosphotransferase 1 | XM_006513454.2 | 79.4% | 79.5% | (many diffs) |
| 12 | mouse | 212862 | Chpt1 | choline phosphotransferase 1 | NR_027477.1 | 69.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1284
- ORF length:
- 1218
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc ggcaggcgcc ggggccgggt ccgcgccgcg ctggctgagg gcgctgagcg 121 agccgctgag cgcggcgcag ctgcggcgac tggaggagca ccgctacagc gcggcgggcg 181 tctcgctgct cgagccgccg ctgcagctct actggacctg gctgctccag tggatcccgc 241 tctggatggc ccccaactcc atcaccctgc tggggctcgc cgtcaacgtg gtcaccacgc 301 tcgtgctcat ctcctactgt cccacggcca ccgaagaggc accatactgg acataccttt 361 tatgtgcact gggacttttt atttaccagt cactggatgc tattgatggg aaacaagcca 421 gaagaacaaa ctcttgttcc cctttagggg agctctttga ccatggctgt gactctcttt 481 ccacagtatt tatggcagtg ggagcttcaa ttgccgctcg cttaggaact tatcctgact 541 ggtttttttt ctgctctttt attgggatgt ttgtgtttta ttgcgctcat tggcagactt 601 atgtttcagg catgttgaga tttggaaaag tggatgtaac tgaaattcag atagctttag 661 tgattgtctt tgtgttgtct gcatttggag gagcaacaat gtgggactat acgattccta 721 ttctagaaat aaaattgaag atccttccag ttcttggatt tctaggtgga gtaatatttt 781 cctgttcaaa ttatttccat gttatcctcc atggtggtgt tggcaagaat ggatccacta 841 tagcaggcac cagtgtcttg tcacctggac tccacatagg actaattatt atactggcaa 901 taatgatcta taaaaagtca gcaactgatg tgtttgaaaa gcatccttgt ctttatatcc 961 taatgtttGG ATGTGTCTTT GCTAAAGTCT CACAAAAATT AGTGGTAGCT CACATGACCA 1021 AAAGTGAACT ATATCTTCAA GACACTGTCT TTTTGGGGCC AGGTCTTTTG TTTTTAGACC 1081 AGTACTTTAA TAACTTTATA GACGAATATG TTGTTCTATG GATGGCAATG GTGATTTCTT 1141 CATTTGATAT GGTGATATAC TTTAGTGCTT TGTGCCTGCA AATTTCAAGA CACCTTCATC 1201 TAAATATATT CAAGACTGCA TGTCATCAAG CACCTGAACA GGTTCAAGTT CTTTCTTCAA 1261 AGAGTCATCA GAATAACATG GATTGCCCAA CTTTCTTGTA CAAAGTGGTT GATATCGGTA 1321 AGCCTATCCC TAACCCTCTC CTCGGTCTCG ATTCTACGTA GTAATGAACT AGTCCGTAAC 1381 TTGAAAGTAT TTCGATTTCT TGGCTTTATA TATCTTGTGG AAAGGACGAC TTCCAGTTAG 1441 ACTACCGGGT CCGACGCGTT AAGTCgacaa tcaacctctg gattacaaaa tttgtgaaag 1501 att