Transcript: Mouse XM_006513454.2

PREDICTED: Mus musculus choline phosphotransferase 1 (Chpt1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Chpt1 (212862)
Length:
4624
CDS:
109..1197

Additional Resources:

NCBI RefSeq record:
XM_006513454.2
NBCI Gene record:
Chpt1 (212862)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006513454.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000103291 CCTGGACTCCACATAGGATTA pLKO.1 775 CDS 100% 10.800 8.640 N Chpt1 n/a
2 TRCN0000288410 CCTGGACTCCACATAGGATTA pLKO_005 775 CDS 100% 10.800 8.640 N Chpt1 n/a
3 TRCN0000103292 CCTTCATCTAAACATCTTCAA pLKO.1 1104 CDS 100% 4.950 3.465 N Chpt1 n/a
4 TRCN0000288344 CCTTCATCTAAACATCTTCAA pLKO_005 1104 CDS 100% 4.950 3.465 N Chpt1 n/a
5 TRCN0000103294 GCACCATACTGGACATACCTT pLKO.1 382 CDS 100% 3.000 2.100 N Chpt1 n/a
6 TRCN0000288409 GCACCATACTGGACATACCTT pLKO_005 382 CDS 100% 3.000 2.100 N Chpt1 n/a
7 TRCN0000082018 CCATCTGTAATGGGATCCTAT pLKO.1 2718 3UTR 100% 4.950 2.475 Y Zfp1 n/a
8 TRCN0000182716 CCTGAGTTCAATTCCCAGCAA pLKO.1 2679 3UTR 100% 2.640 1.320 Y BC028528 n/a
9 TRCN0000054408 ACGCCTTTAATCCCAGCACTT pLKO.1 2483 3UTR 100% 4.050 2.025 Y Mtif2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006513454.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03768 pDONR223 100% 79.4% 79.5% None (many diffs) n/a
2 ccsbBroad304_03768 pLX_304 0% 79.4% 79.5% V5 (many diffs) n/a
3 TRCN0000477025 CTTCCAGTTAGACTACCGGGTCCG pLX_317 26.3% 79.4% 79.5% V5 (many diffs) n/a
Download CSV