Construct: ORF TRCN0000477222
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF011011.1_s317c1
- Derived from:
- ccsbBroadEn_06784
- DNA Barcode:
- GTACCTAGGACCTAGTCATAGTTG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PRSS1 (5644)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000477222
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 5644 | PRSS1 | serine protease 1 | NM_002769.5 | 99.8% | 99.5% | 10C>T |
| 2 | human | 5645 | PRSS2 | serine protease 2 | NM_002770.4 | 92.7% | 89% | (many diffs) |
| 3 | human | 5646 | PRSS3 | serine protease 3 | NM_002771.3 | 91.7% | 87% | (many diffs) |
| 4 | human | 5645 | PRSS2 | serine protease 2 | NM_001303414.1 | 87.7% | 84.2% | (many diffs) |
| 5 | human | 5646 | PRSS3 | serine protease 3 | NM_001197098.1 | 87.1% | 83.8% | (many diffs) |
| 6 | human | 5646 | PRSS3 | serine protease 3 | NM_001197097.2 | 84.5% | 78.9% | (many diffs) |
| 7 | human | 154754 | PRSS3P2 | PRSS3 pseudogene 2 | NR_001296.3 | 78.7% | (many diffs) | |
| 8 | human | 5645 | PRSS2 | serine protease 2 | NR_130149.2 | 76% | (many diffs) | |
| 9 | human | 5646 | PRSS3 | serine protease 3 | NM_007343.3 | 73.1% | 68.7% | (many diffs) |
| 10 | human | 5646 | PRSS3 | serine protease 3 | XM_011517965.1 | 65.9% | 59.8% | (many diffs) |
| 11 | human | 5644 | PRSS1 | serine protease 1 | XM_011516411.1 | 52.2% | 52.1% | 1_675del;685C>T |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 810
- ORF length:
- 741
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gaatccattc ctgatcctta cctttgtggc agctgctctt gctgccccct 121 ttgatgatga tgacaagatc gttgggggct acaactgtga ggagaattct gtcccctacc 181 aggtgtccct gaattctggc taccacttct gtggtggctc cctcatcaac gaacagtggg 241 tggtatcagc aggccactgc tacaagtccc gcatccaggt gagactggga gagcacaaca 301 tcgaagtcct ggaggggaat gagcagttca tcaatgcagc caagatcatc cgccaccccc 361 aatacgacag gaagactctg aacaatgaca tcatgttaat caagctctcc tcacgtgcag 421 taatcaacgc ccgcgtgtcc accatctctc tgcccaccgc cccTCCAGCC ACTGGCACGA 481 AGTGCCTCAT CTCTGGCTGG GGCAACACTG CGAGCTCTGG CGCCGACTAC CCAGACGAGC 541 TGCAGTGCCT GGATGCTCCT GTGCTGAGCC AGGCTAAGTG TGAAGCCTCC TACCCTGGAA 601 AGATTACCAG CAACATGTTC TGTGTGGGCT TCCTTGAGGG AGGCAAGGAT TCATGTCAGG 661 GTGATTCTGG TGGCCCTGTG GTCTGCAATG GACAGCTCCA AGGAGTTGTC TCCTGGGGTG 721 ATGGCTGTGC CCAGAAGAAC AAGCCTGGAG TCTACACCAA GGTCTACAAC TATGTGAAAT 781 GGATTAAGAA CACCATAGCT GCCAATAGCT TGCCAACTTT CTTGTACAAA GTGGTTGATA 841 TCGGTAAGCC TATCCCTAAC CCTCTCCTCG GTCTCGATTC TACGTAGTAA TGAACTAGTC 901 CGTAACTTGA AAGTATTTCG ATTTCTTGGC TTTATATATC TTGTGGAAAG GACGAGTACC 961 TAGGACCTAG TCATAGTTGA CGCGTTAAGT Cgacaatcaa cctctggatt acaaaatttg 1021 tgaaagatt