Construct: ORF TRCN0000477259
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF004256.1_s317c1
- Derived from:
- ccsbBroadEn_12000
- DNA Barcode:
- GCGTAGCGCACTGATAATCGTCGC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PIAS4 (51588)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000477259
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 51588 | PIAS4 | protein inhibitor of activa... | XM_017026868.1 | 82% | 82.1% | 1_171del;453T>C |
2 | human | 51588 | PIAS4 | protein inhibitor of activa... | NM_015897.4 | 51.3% | 51.3% | 1_744del;1026T>C |
3 | human | 51588 | PIAS4 | protein inhibitor of activa... | XM_011528060.2 | 49.4% | 49.5% | 1_801del;1083T>C |
4 | mouse | 59004 | Pias4 | protein inhibitor of activa... | NM_021501.4 | 43.9% | 45.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 855
- ORF length:
- 786
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gtacctgtcc tcggccacca accgcatcac tgtcacctgg gggaactacg 121 gcaagagcta ctcggtggcc ctgtacctgg tgcggcagct gacctcatcg gagctgctgc 181 agaggctgaa gaccattggg gtaaagcacc cggagctgtg caaggcactg gtcaaggaga 241 agctgcgcct tgatcctgac agcgagatcg ccaccaccgg tgtgcgggtg tccctcatct 301 gtccgctggt gaagatgcgg ctctccgtgc cctgccgggc agagacctgc gcccacctgc 361 agtgcttcga cgccgtcttc tacctgcaga tgaacgagaa gaagcccacc tggatgtgcc 421 ccgtgtgcga caagccagcc ccctacgacc agctcatcat cgacgggctc ctctcgaaga 481 tcctgagcga gtgtgaggac gccgacgaga tcgagtacct gGTGGACGGC TCGTGGTGCC 541 CGATCCGCGC CGAAAAGGAG CGCAGCTGCA GCCCGCAGGG CGCCATCCTC GTGCTGGGCC 601 CCTCGGACGC CAATGGGCTC CTGCCCGCCC CCAGCGTCAA CGGGAGCGGT GCCCTGGGCA 661 GCACGGGTGG CGGCGGCCCG GTGGGCAGCA TGGAGAATGG GAAGCCGGGC GCCGATGTGG 721 TGGACCTCAC GCTGGACAGC TCATCGTCCT CGGAGGATGA GGAGGAGGAG GAAGAGGAGG 781 AGGAAGACGA GGACGAAGAG GGGCCCCGGC CCAAGCGCCG CTGCCCCTTC CAGAAGGGCC 841 TGGTGCCGGC CTGCTTGCCA ACTTTCTTGT ACAAAGTGGT TGATATCGGT AAGCCTATCC 901 CTAACCCTCT CCTCGGTCTC GATTCTACGT AGTAATGAAC TAGTCCGTAA CTTGAAAGTA 961 TTTCGATTTC TTGGCTTTAT ATATCTTGTG GAAAGGACGA GCGTAGCGCA CTGATAATCG 1021 TCGCACGCGT TAAGTCgaca atcaacctct ggattacaaa atttgtgaaa gatt