Transcript: Human XM_017026868.1

PREDICTED: Homo sapiens protein inhibitor of activated STAT 4 (PIAS4), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PIAS4 (51588)
Length:
3027
CDS:
557..1516

Additional Resources:

NCBI RefSeq record:
XM_017026868.1
NBCI Gene record:
PIAS4 (51588)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017026868.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000231892 GCTCTACGGAAAGTACTTAAA pLKO_005 303 5UTR 100% 13.200 18.480 N PIAS4 n/a
2 TRCN0000231894 TGCTGAAGCCCACCGAATTAG pLKO_005 407 5UTR 100% 13.200 18.480 N PIAS4 n/a
3 TRCN0000004117 GCCGTTCTTTAATATGCTGGA pLKO.1 381 5UTR 100% 2.160 1.728 N PIAS4 n/a
4 TRCN0000231895 GAACTGCAGCCCGGAGTTAAA pLKO_005 514 5UTR 100% 13.200 9.240 N PIAS4 n/a
5 TRCN0000231893 TGGTGAAGCTGCCGTTCTTTA pLKO_005 371 5UTR 100% 13.200 9.240 N PIAS4 n/a
6 TRCN0000004115 CACCGAATTAGTCCCACAGAA pLKO.1 417 5UTR 100% 4.950 3.465 N PIAS4 n/a
7 TRCN0000004118 CCACAGAACAACGAGAAGCTT pLKO.1 430 5UTR 100% 3.000 2.100 N PIAS4 n/a
8 TRCN0000004116 CGCACACTCGACTTTCCTGGT pLKO.1 1524 3UTR 100% 0.720 0.504 N PIAS4 n/a
9 TRCN0000004119 GCCAAGAAGAACTCGGAGCCT pLKO.1 172 5UTR 100% 0.220 0.154 N PIAS4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017026868.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12000 pDONR223 100% 82% 82.1% None 1_171del;453T>C n/a
2 ccsbBroad304_12000 pLX_304 0% 82% 82.1% V5 1_171del;453T>C n/a
3 TRCN0000477259 GCGTAGCGCACTGATAATCGTCGC pLX_317 42.5% 82% 82.1% V5 1_171del;453T>C n/a
4 ccsbBroadEn_11999 pDONR223 100% 63.6% 63.4% None (many diffs) n/a
5 ccsbBroad304_11999 pLX_304 0% 63.6% 63.4% V5 (many diffs) n/a
6 TRCN0000469447 TTGCCGAACCGCGCACTCAGAATC pLX_317 27.7% 63.6% 63.4% V5 (many diffs) n/a
Download CSV