Construct: ORF TRCN0000477315
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF002610.1_s317c1
- Derived from:
- ccsbBroadEn_11688
- DNA Barcode:
- GGCATTCAGGACGACCTGCGGCGG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- METAP1 (23173)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000477315
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 23173 | METAP1 | methionyl aminopeptidase 1 | XM_024453948.1 | 100% | 100% | |
2 | human | 23173 | METAP1 | methionyl aminopeptidase 1 | XM_024453949.1 | 100% | 100% | |
3 | human | 23173 | METAP1 | methionyl aminopeptidase 1 | XM_024453950.1 | 100% | 100% | |
4 | human | 23173 | METAP1 | methionyl aminopeptidase 1 | XM_024453951.1 | 100% | 100% | |
5 | human | 23173 | METAP1 | methionyl aminopeptidase 1 | XM_017007915.2 | 92.8% | 92.8% | 1_63del |
6 | human | 23173 | METAP1 | methionyl aminopeptidase 1 | XM_017007916.2 | 92.8% | 92.8% | 1_63del |
7 | human | 23173 | METAP1 | methionyl aminopeptidase 1 | XM_017007917.2 | 92.8% | 92.8% | 1_63del |
8 | human | 23173 | METAP1 | methionyl aminopeptidase 1 | XM_024453952.1 | 77.8% | 77.8% | 1_63del;375_376ins132 |
9 | human | 23173 | METAP1 | methionyl aminopeptidase 1 | XM_011531778.2 | 77.4% | 77.4% | 1_237del |
10 | human | 23173 | METAP1 | methionyl aminopeptidase 1 | XM_011531777.3 | 72.9% | 72.9% | 1_303del |
11 | human | 23173 | METAP1 | methionyl aminopeptidase 1 | NM_015143.3 | 70.4% | 70.4% | 1_342del |
12 | human | 23173 | METAP1 | methionyl aminopeptidase 1 | XM_024453947.1 | 64.9% | 64.9% | 1_237del;549_550ins132 |
13 | human | 23173 | METAP1 | methionyl aminopeptidase 1 | XM_024453946.1 | 61.1% | 61.1% | 1_303del;615_616ins132 |
14 | human | 23173 | METAP1 | methionyl aminopeptidase 1 | XM_011531779.2 | 59% | 59% | 1_342del;654_655ins132 |
15 | human | 23173 | METAP1 | methionyl aminopeptidase 1 | XM_017007914.2 | 58% | 57.7% | 1_342del;787_788ins144 |
16 | mouse | 75624 | Metap1 | methionyl aminopeptidase 1 | NM_175224.4 | 63.5% | 69.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 882
- ORF length:
- 816
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtc tgaatctgaa caggctctta aaggtacttc tcagattaaa ttactctcat 121 ctgaagatat agaagggatg cgacttgtat gtaggcttgc tagagaagtt ttggatgttg 181 ctgccggcat gattaaacca ggtgtaacta ctgaagaaat agatcacgct gtacacttag 241 catgtattgc aagaaattgc tacccttctc ccctgaatta ttataatttc ccaaagtctt 301 gttgtacctc agtgaatgaa gtcatttgcc atggaatacc agacagaagg cccttacaag 361 aaggtgacat tgttaatgtg gatatcactc tttatcgcaa tggttatcat ggggacctga 421 atgagacatt ttttgttgga gaagtggatg atggagcacg gaaacttgtt cagaccacat 481 atgagtgcct gatgcaagcc attgatgcag tgaagcctgg tgttcggtac agagaattgg 541 gaaacattat ccagaagcat gcccaagcaa atgggttttc agttgttcga agctattgtg 601 ggcatggaat ccacaagctt tttcatacag ctccCAATGT ACCCCACTAT GCTAAAAATA 661 AAGCAGTTGG AGTGATGAAG TCGGGCCATG TATTTACAAT TGAGCCAATG ATTTGTGAAG 721 GCGGATGGCA GGATGAAACC TGGCCAGATG GTTGGACTGC GGTGACAAGA GACGGAAAGC 781 GGTCTGCTCA GTTTGAGCAC ACCCTCCTGG TCACAGACAC TGGCTGTGAA ATCCTAACCC 841 GGCGACTTGA CAGTGCACGG CCTCACTTCA TGTCTCAATT TTACCCAACT TTCTTGTACA 901 AAGTGGTTGA TATCGGTAAG CCTATCCCTA ACCCTCTCCT CGGTCTCGAT TCTACGTAGT 961 AATGAACTAG TCCGTAACTT GAAAGTATTT CGATTTCTTG GCTTTATATA TCTTGTGGAA 1021 AGGACGAGGC ATTCAGGACG ACCTGCGGCG GACGCGTTAA GTCgacaatc aacctctgga 1081 ttacaaaatt tgtgaaagat t