Transcript: Mouse NM_175224.4

Mus musculus methionyl aminopeptidase 1 (Metap1), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Metap1 (75624)
Length:
2549
CDS:
12..1172

Additional Resources:

NCBI RefSeq record:
NM_175224.4
NBCI Gene record:
Metap1 (75624)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_175224.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000322599 TTACAATTGAGCCAATGATTT pLKO_005 982 CDS 100% 13.200 9.240 N METAP1 n/a
2 TRCN0000031767 CACGGAAACTTGTTCAGACTA pLKO.1 745 CDS 100% 4.950 3.465 N Metap1 n/a
3 TRCN0000287482 CACGGAAACTTGTTCAGACTA pLKO_005 745 CDS 100% 4.950 3.465 N Metap1 n/a
4 TRCN0000031764 CCTCATTTCATGTCCCAGTTT pLKO.1 1149 CDS 100% 4.950 3.465 N Metap1 n/a
5 TRCN0000287563 CCTCATTTCATGTCCCAGTTT pLKO_005 1149 CDS 100% 4.950 3.465 N Metap1 n/a
6 TRCN0000031766 CCTTTGCAAGAAGGTGATATT pLKO.1 639 CDS 100% 13.200 7.920 N Metap1 n/a
7 TRCN0000287479 CCTTTGCAAGAAGGTGATATT pLKO_005 639 CDS 100% 13.200 7.920 N Metap1 n/a
8 TRCN0000031765 GCCACTCACAAGTTACTACAT pLKO.1 147 CDS 100% 4.950 2.970 N Metap1 n/a
9 TRCN0000287562 GCCACTCACAAGTTACTACAT pLKO_005 147 CDS 100% 4.950 2.970 N Metap1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175224.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11688 pDONR223 100% 63.5% 69.1% None (many diffs) n/a
2 ccsbBroad304_11688 pLX_304 0% 63.5% 69.1% V5 (many diffs) n/a
3 TRCN0000477315 GGCATTCAGGACGACCTGCGGCGG pLX_317 30.8% 63.5% 69.1% V5 (many diffs) n/a
Download CSV