Construct: ORF TRCN0000477462
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF007896.1_s317c1
- Derived from:
- ccsbBroadEn_04676
- DNA Barcode:
- GACACTTGAAACCGTGCCCGATTA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- KCTD12 (115207)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000477462
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 115207 | KCTD12 | potassium channel tetrameri... | NM_138444.4 | 100% | 100% | |
| 2 | mouse | 239217 | Kctd12 | potassium channel tetrameri... | NM_177715.4 | 93.9% | 98.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1041
- ORF length:
- 975
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc tctggcggac agcacacgtg gattacccaa cgggggcggc ggcgggggcg 121 gcagtggctc ctcgtcgtcc tccgcggagc caccgctctt ccccgacatc gtggagctga 181 acgtgggggg ccaggtgtac gtgacccggc gctgcacggt ggtgtcggtg cccgactcgc 241 tgctctggcg catgttcacg cagcagcagc cgcaggagct ggcccgggac agcaaaggcc 301 gcttctttct ggaccgggac ggcttcctct tccgctacat cctggattac ctgcgggact 361 tgcagctcgt gctgcccgac tacttccccg agcgcagccg gctgcagcgc gaggccgagt 421 acttcgagct gccagagctc gtgcgccgcc tcggggcgcc ccagcagccc ggcccggggc 481 cgccgccctc gcggcgcggg gtgcacaagg agggctcgct gggtgacgag ctgctgccgc 541 ttggctactc ggagcccgaa cagcaggagg gcgcctctgc cggggcgccg tcgcccacgc 601 tggagctggc tagccgcagT CCGTCCGGGG GCGCGGCGGG CCCGCTGCTC ACGCCGTCCC 661 AGTCGCTGGA CGGCAGCCGG CGCTCGGGCT ACATCACCAT CGGCTACCGC GGCTCCTACA 721 CCATCGGGCG GGACGCGCAG GCGGACGCCA AGTTCCGGCG AGTGGCGCGC ATCACCGTTT 781 GCGGAAAGAC GTCGCTGGCC AAGGAGGTGT TTGGGGACAC CCTGAACGAA AGCCGGGACC 841 CCGACCGTCC CCCGGAGCGC TACACCTCGC GCTATTACCT CAAGTTCAAC TTCCTGGAGC 901 AGGCCTTCGA CAAGCTGTCC GAGTCGGGCT TCCACATGGT GGCGTGCAGC TCCACGGGCA 961 CCTGCGCCTT TGCCAGCAGC ACCGACCAGA GCGAGGACAA GATCTGGACC AGCTACACCG 1021 AGTACGTCTT CTGCAGGGAG TGCCCAACTT TCTTGTACAA AGTGGTTGAT ATCGGTAAGC 1081 CTATCCCTAA CCCTCTCCTC GGTCTCGATT CTACGTAGTA ATGAACTAGT CCGTAACTTG 1141 AAAGTATTTC GATTTCTTGG CTTTATATAT CTTGTGGAAA GGACGAGACA CTTGAAACCG 1201 TGCCCGATTA ACGCGTTAAG TCgacaatca acctctggat tacaaaattt gtgaaagatt