Transcript: Mouse NM_177715.4

Mus musculus potassium channel tetramerisation domain containing 12 (Kctd12), mRNA.

Source:
NCBI, updated 2017-04-22
Taxon:
Mus musculus (mouse)
Gene:
Kctd12 (239217)
Length:
6076
CDS:
198..1181

Additional Resources:

NCBI RefSeq record:
NM_177715.4
NBCI Gene record:
Kctd12 (239217)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_177715.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000217763 CGAGCAATAACGCGGTATTTA pLKO.1 2690 3UTR 100% 15.000 21.000 N Kctd12 n/a
2 TRCN0000043917 CTTCCGCTACATCCTGGATTA pLKO.1 461 CDS 100% 10.800 7.560 N KCTD12 n/a
3 TRCN0000175497 CCGCTATTACCTCAAGTTCAA pLKO.1 1007 CDS 100% 4.950 3.465 N Kctd12 n/a
4 TRCN0000193422 CCTGTGAATTTGATGACTGTA pLKO.1 4147 3UTR 100% 4.950 3.465 N Kctd12 n/a
5 TRCN0000175168 GCTATTACCTCAAGTTCAACT pLKO.1 1009 CDS 100% 4.950 3.465 N Kctd12 n/a
6 TRCN0000193683 CAAGTTCAACTTCCTAGAGCA pLKO.1 1019 CDS 100% 2.640 1.848 N Kctd12 n/a
7 TRCN0000043915 CGGCTTCCTCTTCCGCTACAT pLKO.1 452 CDS 100% 1.650 1.155 N KCTD12 n/a
8 TRCN0000175451 CCTCAAGTTCAACTTCCTAGA pLKO.1 1016 CDS 100% 4.050 2.430 N Kctd12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177715.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04676 pDONR223 100% 93.9% 98.7% None (many diffs) n/a
2 ccsbBroad304_04676 pLX_304 0% 93.9% 98.7% V5 (many diffs) n/a
3 TRCN0000477462 GACACTTGAAACCGTGCCCGATTA pLX_317 43.4% 93.9% 98.7% V5 (many diffs) n/a
Download CSV