Construct: ORF TRCN0000477464
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF018266.1_s317c1
- Derived from:
- ccsbBroadEn_05044
- DNA Barcode:
- GACTGCTAAACTTCAAATTACTGC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TCF23 (150921)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000477464
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 150921 | TCF23 | transcription factor 23 | NM_175769.3 | 100% | 100% | |
| 2 | human | 150921 | TCF23 | transcription factor 23 | XM_005264159.5 | 90.5% | 90.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 711
- ORF length:
- 642
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gtcacagagg aaggccagag ggccaccagc catgccaggg gtggggcata 121 gccagactca ggccaaagca cggttgctgc caggcgctga caggaagagg agccgcctca 181 gcaggacaag gcaggacccg tgggaagaaa gaagctggag caaccagaga tggagcagag 241 ctacccctgg ccctcgaggg accagggctg ggggcctggc tcttggcagg agcgaggcca 301 gtcctgagaa tgccgcgcgg gagcggagcc gggtcaggac gctgcgccag gccttcttgg 361 ccttgcaggc tgctctgcct gccgtgccgc ccgacaccaa gctctccaag ttggacgtgc 421 tggtgctcgc cgccagctac atagcccacc TCACCCGCAC ACTCGGCCAC GAGTTGCCTG 481 GCCCTGCCTG GCCGCCCTTC CTGCGTGGAC TCCGCTACTT GCACCCTCTC AAGAAGTGGC 541 CGATGCGATC TCGTCTCTAT GCTGGAGGCC TGGGGTACTC CGATCTTGAC TCCACCACAG 601 CCAGCACCCC CAGCCAAAGA ACAAGAGATG CAGAGGTGGG GTCCCAAGTC CCTGGAGAGG 661 CAGATGCTCT CCTTTCCACC ACACCACTCT CACCAGCTCT TGGTGACAAA TTGCCAACTT 721 TCTTGTACAA AGTGGTTGAT ATCGGTAAGC CTATCCCTAA CCCTCTCCTC GGTCTCGATT 781 CTACGTAGTA ATGAACTAGT CCGTAACTTG AAAGTATTTC GATTTCTTGG CTTTATATAT 841 CTTGTGGAAA GGACGAGACT GCTAAACTTC AAATTACTGC ACGCGTTAAG TCgacaatca 901 acctctggat tacaaaattt gtgaaagatt