Transcript: Human XM_005264159.5

PREDICTED: Homo sapiens transcription factor 23 (TCF23), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TCF23 (150921)
Length:
1502
CDS:
243..875

Additional Resources:

NCBI RefSeq record:
XM_005264159.5
NBCI Gene record:
TCF23 (150921)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005264159.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000245204 CGATGCGATCTCGTCTCTATG pLKO_005 715 CDS 100% 10.800 15.120 N TCF23 n/a
2 TRCN0000245202 GCTACTTGCACCCTCTCAAGA pLKO_005 688 CDS 100% 4.950 6.930 N TCF23 n/a
3 TRCN0000020763 GCCGCCAGCTACATAGCCCAC pLKO.1 603 CDS 100% 0.000 0.000 N LOC391360 n/a
4 TRCN0000245203 CTCTCAAGAAGTGGCCGATGC pLKO_005 700 CDS 100% 0.750 0.600 N TCF23 n/a
5 TRCN0000245201 AGGACCCGTGGGAAGAAAGAA pLKO_005 367 CDS 100% 5.625 3.938 N TCF23 n/a
6 TRCN0000020762 GCGCCAGGCCTTCTTGGCCTT pLKO.1 518 CDS 100% 0.000 0.000 N LOC391360 n/a
7 TRCN0000245200 ATAGCCAGACTCAGGCCAAAG pLKO_005 292 CDS 100% 6.000 3.600 N TCF23 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005264159.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05044 pDONR223 100% 90.5% 90.2% None (many diffs) n/a
2 ccsbBroad304_05044 pLX_304 0% 90.5% 90.2% V5 (many diffs) n/a
3 TRCN0000477464 GACTGCTAAACTTCAAATTACTGC pLX_317 40.7% 90.5% 90.2% V5 (many diffs) n/a
Download CSV