Construct: ORF TRCN0000477489
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF016078.1_s317c1
- Derived from:
- ccsbBroadEn_00273
- DNA Barcode:
- ATTTTAAAACAAGAACTGGCAATT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CDC25B (994)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000477489
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 994 | CDC25B | cell division cycle 25B | NM_021873.3 | 100% | 100% | |
| 2 | human | 994 | CDC25B | cell division cycle 25B | NM_004358.4 | 97.5% | 97.5% | 196_197ins42 |
| 3 | human | 994 | CDC25B | cell division cycle 25B | NM_021872.3 | 92.9% | 92.9% | 459_460ins123 |
| 4 | human | 994 | CDC25B | cell division cycle 25B | NM_001287516.1 | 88.9% | 88.9% | 0_1ins174;5_6insCGACCTCGCCGGGCTCGG |
| 5 | human | 994 | CDC25B | cell division cycle 25B | NM_001287517.1 | 86.3% | 86.2% | 1_1delAins235;3G>C;5A>G |
| 6 | human | 994 | CDC25B | cell division cycle 25B | NM_001287518.1 | 84.3% | 84.3% | 0_1ins174;5_6insCGACCTCGCCGGGCTCGG;644_645ins81 |
| 7 | human | 994 | CDC25B | cell division cycle 25B | NM_001287519.1 | 80.6% | 80.6% | 0_1ins336 |
| 8 | human | 994 | CDC25B | cell division cycle 25B | NM_001287520.1 | 80.6% | 80.6% | 0_1ins336 |
| 9 | human | 994 | CDC25B | cell division cycle 25B | NM_001287522.1 | 73.6% | 73.6% | 0_1ins336;123_124ins123 |
| 10 | human | 994 | CDC25B | cell division cycle 25B | NM_001287524.1 | 66.5% | 66.5% | 0_1ins580;3_6delGCCG |
| 11 | human | 994 | CDC25B | cell division cycle 25B | XR_937181.3 | 57% | 1_69del;1262_1340del;1889_3048del | |
| 12 | human | 994 | CDC25B | cell division cycle 25B | NR_136335.1 | 54.2% | (many diffs) | |
| 13 | human | 994 | CDC25B | cell division cycle 25B | NR_136336.1 | 52.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1806
- ORF length:
- 1740
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga ggtgccccag ccggagcccg cgccaggctc ggctctcagt ccagcaggcg 121 tgtgcggtgg cgcccagcgt ccgggccacc tcccgggcct cctgctggga tctcatggcc 181 tcctggggtc cccggtgcgg gcggccgctt cctcgccggt caccaccctc acccagacca 241 tgcacgacct cgccgggctc ggcagcgaaa ccccaaagag tcaggtaggg accctgctct 301 tccgcagccg cagccgcctg acgcacctat ccctgtctcg acgggcatcc gaatcctccc 361 tgtcgtctga atcctccgaa tcttctgatg caggtctctg catggattcc cccagcccta 421 tggaccccca catggcggag cagacgtttg aacaggccat ccaggcagcc agccggatca 481 ttcgaaacga gcagtttgcc atcagacgct tccagtctat gccggtgagg ctgctgggcc 541 acagccccgt gcttcggaac atcaccaact cccaggcgcc cgacggccgg aggaagagcg 601 aggcgggcag tggagctgcc agcagctctg gggaagacaa ggagaatgat ggatttgtct 661 tcaagatgcc atggaagccc acacatccca gctccaccca tgctctggca gagtgggcca 721 gccgcaggga agcctttgcc cagagaccca gctcggcccc cgacctgatg tgtctcagtc 781 ctgaccggaa gatggaagtg gaggagctca gccccctggc cctaggtcgc ttctctctga 841 cccctgcaga gggggatact gaggaagatg atggatttgt ggacatccta gagagtgact 901 taaaggatga tgatgcagtt cccccaggca tggagagtct cattagtgcc ccactggtca 961 agaccttgga aaaggaagag gaaaaggacc tcgtcatgta cagcaagtgc cagcggctct 1021 tccgctctcc gtccatgccc tgcagcgtga tccggcccat cctcaagagg ctggagcggc 1081 cccaggacag ggacacgccc gtgcagaata agcggaggcg gagcgtgacc cctcctgagg 1141 agcagcagga ggctgaggaa cctaaagccc gcgtcctccg ctcaaaatca ctgtgtcacg 1201 atgagatcga gaacctcctg gacagtgacc accgagagct gattggagat tactctaagg 1261 ccttcctcct acagacagta gacggaaagc accaagacct caagtacatc tcaccagaaa 1321 cgatggtggc cctattgacg ggcaagttca gcaacatcgt ggataagttt gtgattgtag 1381 actgcagata cccctatgaa tatgaaggcg ggcacatcaa gactgcggtg aacttgcccc 1441 tggaacgcga cgccgagagc ttccTACTGA AGAGCCCCAT CGCGCCCTGT AGCCTGGACA 1501 AGAGAGTCAT CCTCATTTTC CACTGTGAAT TCTCATCTGA GCGTGGGCCC CGCATGTGCC 1561 GTTTCATCAG GGAACGAGAC CGTGCTGTCA ACGACTACCC CAGCCTCTAC TACCCTGAGA 1621 TGTATATCCT GAAAGGCGGC TACAAGGAGT TCTTCCCTCA GCACCCGAAC TTCTGTGAAC 1681 CCCAGGACTA CCGGCCCATG AACCACGAGG CCTTCAAGGA TGAGCTAAAG ACCTTCCGCC 1741 TCAAGACTCG CAGCTGGGCT GGGGAGCGGA GCCGGCGGGA GCTCTGTAGC CGGCTGCAGG 1801 ACCAGTGCCC AACTTTCTTG TACAAAGTGG TTGATATCGG TAAGCCTATC CCTAACCCTC 1861 TCCTCGGTCT CGATTCTACG TAGTAATGAA CTAGTCCGTA ACTTGAAAGT ATTTCGATTT 1921 CTTGGCTTTA TATATCTTGT GGAAAGGACG AATTTTAAAA CAAGAACTGG CAATTACGCG 1981 TTAAGTCgac aatcaacctc tggattacaa aatttgtgaa agatt