Transcript: Human NM_004358.4

Homo sapiens cell division cycle 25B (CDC25B), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-21
Taxon:
Homo sapiens (human)
Gene:
CDC25B (994)
Length:
3654
CDS:
794..2494

Additional Resources:

NCBI RefSeq record:
NM_004358.4
NBCI Gene record:
CDC25B (994)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004358.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000002512 CCGAGAGCTGATTGGAGATTA pLKO.1 1918 CDS 100% 13.200 18.480 N CDC25B n/a
2 TRCN0000277861 CCGAGAGCTGATTGGAGATTA pLKO_005 1918 CDS 100% 13.200 18.480 N CDC25B n/a
3 TRCN0000002510 GCTTCCAGTCTATGCCGGTGA pLKO.1 1194 CDS 100% 0.720 1.008 N CDC25B n/a
4 TRCN0000286048 GCTTCCAGTCTATGCCGGTGA pLKO_005 1194 CDS 100% 0.720 1.008 N CDC25B n/a
5 TRCN0000002509 CGTCTGAATCCTCCGAATCTT pLKO.1 1050 CDS 100% 5.625 3.938 N CDC25B n/a
6 TRCN0000277862 CGTCTGAATCCTCCGAATCTT pLKO_005 1050 CDS 100% 5.625 3.938 N CDC25B n/a
7 TRCN0000002513 GCTGTCTTGTTGCGGATGGAT pLKO.1 3311 3UTR 100% 3.000 2.100 N CDC25B n/a
8 TRCN0000277863 GCTGTCTTGTTGCGGATGGAT pLKO_005 3311 3UTR 100% 3.000 2.100 N CDC25B n/a
9 TRCN0000002511 CCTCAAGTACATCTCACCAGA pLKO.1 1984 CDS 100% 2.640 1.848 N CDC25B n/a
10 TRCN0000297052 CCTCAAGTACATCTCACCAGA pLKO_005 1984 CDS 100% 2.640 1.848 N CDC25B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004358.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00273 pDONR223 100% 97.5% 97.5% None 196_197ins42 n/a
2 ccsbBroad304_00273 pLX_304 0% 97.5% 97.5% V5 196_197ins42 n/a
3 TRCN0000477489 ATTTTAAAACAAGAACTGGCAATT pLX_317 20% 97.5% 97.5% V5 196_197ins42 n/a
Download CSV