Construct: ORF TRCN0000477529
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF011584.1_s317c1
- Derived from:
- ccsbBroadEn_04441
- DNA Barcode:
- GAGCTGAGCACTGAAACATAGTAC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- C1orf198 (84886)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000477529
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 84886 | C1orf198 | chromosome 1 open reading f... | NM_032800.3 | 100% | 100% | |
| 2 | human | 84886 | C1orf198 | chromosome 1 open reading f... | NM_001136494.2 | 88.3% | 88.3% | 0_1ins114 |
| 3 | human | 84886 | C1orf198 | chromosome 1 open reading f... | NM_001136495.2 | 60.2% | 60.2% | 0_1ins390 |
| 4 | human | 84886 | C1orf198 | chromosome 1 open reading f... | XM_017002599.2 | 60.2% | 60.2% | 0_1ins390 |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1050
- ORF length:
- 981
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggcgtccatg gcggcggcga tcgcggcttc gcgctcggcg gtcatgagcg 121 ggaaccggcc tctggacgac cgggagcgaa agcgcttcac ttacttctcg tcgctgagcc 181 ccatggccag gaagatcatg caggacaagg agaagatccg cgagaagtac gggcccgagt 241 gggcgcggct gccgcccgcg cagcaggacg agatcatcga ccggtgcctg gtggggccgc 301 gcgccccggc gccccgagac cccggggact cggaggagct cacgcgcttc cccggcttgc 361 gcgggcccac gggccagaag gtggtgcgct tcggggacga ggatctaact tggcaagatg 421 agcactctgc ccctttctcc tgggaaacaa agagtcagat ggagttcagt atctccgccc 481 tatccatcca ggagccgagc aacggcaccg ccgccagcga gcccagacca ctgtccaaag 541 cttcccaggg ctcccaggcc ctcaagtcct cccaaggcag caggtcctcc agcctggacg 601 cccTGGGCCC CACCAGGAAG GAGGAGGAAG CGTCATTCTG GAAGATCAAT GCTGAGCGGT 661 CCCGAGGGGA GGGGCCTGAG GCCGAGTTCC AGTCGCTGAC CCCTAGCCAG ATCAAGTCCA 721 TGGAGAAGGG GGAAAAGGTC TTGCCTCCCT GCTACCGGCA GGAACCTGCC CCGAAGGACA 781 GGGAGGCCAA GGTGGAAAGG CCCAGCACCC TCCGTCAGGA GCAGCGTCCT CTTCCCAACG 841 TGAGCACCGA ACGTGAGAGA CCCCAGCCTG TCCAGGCCTT CAGCAGTGCA CTGCACGAGG 901 CTGCCCCCTC CCAGCTCGAG GGGAAGCTGC CATCTCCTGA TGTCAGGCAG GACGATGGGG 961 AAGACACCCT GTTCTCGGAA CCCAAGTTTG CACAGGTCAG CTCAAGTAAT GTCGTCTTGA 1021 AGACGGGATT TGATTTTCTG GACAATTGGT TGCCAACTTT CTTGTACAAA GTGGTTGATA 1081 TCGGTAAGCC TATCCCTAAC CCTCTCCTCG GTCTCGATTC TACGTAGTAA TGAACTAGTC 1141 CGTAACTTGA AAGTATTTCG ATTTCTTGGC TTTATATATC TTGTGGAAAG GACGAGAGCT 1201 GAGCACTGAA ACATAGTACA CGCGTTAAGT Cgacaatcaa cctctggatt acaaaatttg 1261 tgaaagatt