Transcript: Human XM_017002599.2

PREDICTED: Homo sapiens chromosome 1 open reading frame 198 (C1orf198), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
C1orf198 (84886)
Length:
3757
CDS:
431..1024

Additional Resources:

NCBI RefSeq record:
XM_017002599.2
NBCI Gene record:
C1orf198 (84886)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017002599.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000121562 CAGCTCAAGTAATGTCGTCTT pLKO.1 970 CDS 100% 4.050 3.240 N C1orf198 n/a
2 TRCN0000140612 GCACAGGTCAGCTCAAGTAAT pLKO.1 962 CDS 100% 13.200 9.240 N C1orf198 n/a
3 TRCN0000139801 CGTCTTGAAGACGGGATTTGA pLKO.1 985 CDS 100% 5.625 3.938 N C1orf198 n/a
4 TRCN0000122585 CCCTCCTCAAAGGATGTGTTT pLKO.1 1323 3UTR 100% 4.950 3.465 N C1orf198 n/a
5 TRCN0000144315 CTCAAGTAATGTCGTCTTGAA pLKO.1 973 CDS 100% 0.495 0.347 N C1orf198 n/a
6 TRCN0000139557 CCTGGGAAACAAAGAGTCAGA pLKO.1 411 5UTR 100% 2.640 1.584 N C1orf198 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017002599.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04441 pDONR223 100% 60.2% 60.2% None 0_1ins390 n/a
2 ccsbBroad304_04441 pLX_304 0% 60.2% 60.2% V5 0_1ins390 n/a
3 TRCN0000477529 GAGCTGAGCACTGAAACATAGTAC pLX_317 45.5% 60.2% 60.2% V5 0_1ins390 n/a
Download CSV