Construct: ORF TRCN0000477532
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF009682.1_s317c1
- Derived from:
- ccsbBroadEn_06768
- DNA Barcode:
- GTGGCTCTTAGTCTCCCCTGACGT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PRH2 (5555)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000477532
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 5555 | PRH2 | proline rich protein HaeIII... | NM_001110213.1 | 99.7% | 99.3% | 196A>G |
| 2 | human | 5554 | PRH1 | proline rich protein HaeIII... | NM_001291314.2 | 87.5% | 87.7% | (many diffs) |
| 3 | human | 5554 | PRH1 | proline rich protein HaeIII... | NM_001291315.2 | 78.3% | 73% | (many diffs) |
| 4 | human | 100533464 | PRH1-PRR4 | PRH1-PRR4 readthrough | NR_037918.2 | 29.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 567
- ORF length:
- 498
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gcttctgatt ctgctgtcag tggccctgct ggccttcagc tcagctcagg 121 acttagatga agatgtcagc caagaagacg ttcccttggt aatatcagat ggaggagact 181 ctgagcagtt catagatgag gagcgtcagg gaccaccttt gggaggacag caatctcaac 241 cctctgctgg tgatgggaac caggatgatg gccctcagca gggaccaccc caacaaggag 301 gccagcagca acaaggtcca ccacctccTC AGGGAAAGCC ACAAGGACCA CCCCAACAGG 361 GAGGCCATCC CCCTCCTCCT CAAGGAAGGC CACAAGGACC ACCCCAACAG GGAGGCCATC 421 CCCGTCCTCC TCGAGGAAGG CCACAAGGAC CACCCCAACA GGGAGGCCAT CAGCAAGGTC 481 CTCCCCCACC TCCTCCTGGA AAGCCCCAGG GACCACCTCC CCAAGGGGGC CGCCCACAAG 541 GACCTCCACA GGGGCAGTCT CCTCAGTTGC CAACTTTCTT GTACAAAGTG GTTGATATCG 601 GTAAGCCTAT CCCTAACCCT CTCCTCGGTC TCGATTCTAC GTAGTAATGA ACTAGTCCGT 661 AACTTGAAAG TATTTCGATT TCTTGGCTTT ATATATCTTG TGGAAAGGAC GAGTGGCTCT 721 TAGTCTCCCC TGACGTACGC GTTAAGTCga caatcaacct ctggattaca aaatttgtga 781 aagatt