Transcript: Human NR_037918.2

Homo sapiens PRH1-PRR4 readthrough (PRH1-PRR4), long non-coding RNA.

Source:
NCBI, updated 2018-05-12
Taxon:
Homo sapiens (human)
Gene:
PRH1-PRR4 (100533464)
Length:
1645
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_037918.2
NBCI Gene record:
PRH1-PRR4 (100533464)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_037918.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000155803 CTTCAGCTCAGCTCAGGATTT pLKO.1 638 3UTR 100% 10.800 5.400 Y PRH1 n/a
2 TRCN0000162036 CTTTCACCATACCAGATGTAG pLKO.1 1206 3UTR 100% 4.950 2.475 Y PRR4 n/a
3 TRCN0000154500 GAAGATGTCAGCCAGGAAGAT pLKO.1 663 3UTR 100% 4.950 2.475 Y PRH1 n/a
4 TRCN0000373241 GACTCTGAGCAGTTCCTAGAT pLKO_005 711 3UTR 100% 4.950 2.475 Y PRH1 n/a
5 TRCN0000154574 GATGTCAGCCAGGAAGATGTT pLKO.1 666 3UTR 100% 4.950 2.475 Y PRH1 n/a
6 TRCN0000159032 GATGTGAACTATGAAGACTTT pLKO.1 1184 3UTR 100% 4.950 2.475 Y PRR4 n/a
7 TRCN0000373240 GTGATGGGAACCAGGATGATG pLKO_005 784 3UTR 100% 4.950 2.475 Y PRH1 n/a
8 TRCN0000373242 TTGGGAGGACAGCAATCTCAA pLKO_005 753 3UTR 100% 4.950 2.475 Y PRH1 n/a
9 TRCN0000373238 ATGAAGATGTCAGCCAGGAAG pLKO_005 661 3UTR 100% 4.050 2.025 Y PRB3 n/a
10 TRCN0000437067 CATTCTTCCAGAGGGACAGAC pLKO_005 1470 3UTR 100% 4.050 2.025 Y PRR4 n/a
11 TRCN0000163905 CTGGTGATAGTGGTAACCAAG pLKO.1 1296 3UTR 100% 4.050 2.025 Y PRR4 n/a
12 TRCN0000447333 CAAGTCAGAGACCAGATCAGG pLKO_005 1233 3UTR 100% 2.640 1.320 Y PRR4 n/a
13 TRCN0000162840 CCATACCAGATGTAGAGGACT pLKO.1 1212 3UTR 100% 2.640 1.320 Y PRR4 n/a
14 TRCN0000155551 CCCTCGTAATATCAGATGGAG pLKO.1 688 3UTR 100% 2.640 1.320 Y PRH1 n/a
15 TRCN0000154881 CCTCGTAATATCAGATGGAGG pLKO.1 689 3UTR 100% 2.160 1.080 Y PRH1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_037918.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11053 pDONR223 100% 34.1% None 1_602del;1164_1645del n/a
2 ccsbBroad304_11053 pLX_304 0% 34.1% V5 1_602del;1164_1645del n/a
3 TRCN0000479810 ACATCTGCGCCTCCCTGGCATATT pLX_317 53.7% 34.1% V5 1_602del;1164_1645del n/a
4 ccsbBroadEn_15535 pDONR223 0% 30.2% None (many diffs) n/a
5 ccsbBroad304_15535 pLX_304 0% 30.2% V5 (many diffs) n/a
6 TRCN0000474069 GGCGGAAAACGGTTCCTCTTGACC pLX_317 76% 30.2% V5 (many diffs) n/a
7 ccsbBroadEn_06768 pDONR223 100% 29.8% None (many diffs) n/a
8 ccsbBroad304_06768 pLX_304 0% 29.8% V5 (many diffs) n/a
9 TRCN0000477532 GTGGCTCTTAGTCTCCCCTGACGT pLX_317 47.7% 29.8% V5 (many diffs) n/a
10 ccsbBroadEn_07791 pDONR223 100% 23.1% None (many diffs) n/a
11 ccsbBroad304_07791 pLX_304 0% 23.1% V5 (many diffs) n/a
12 TRCN0000481102 AAAAACATCTACCATAAAAAAAAC pLX_317 87.2% 23.1% V5 (many diffs) n/a
Download CSV